 The Polymerase chain reaction (PCR) is used to amplify and clone a specific DNA sequence (fragment)  You should be able to list all the reagents and write a brief description about their specific function  You should be able to draw up a list of criteria which need to be met whilst designing matching PCR primers  You should be able to list the pros and cons of PCR being a very sensitive method for the detection of individual DNA sequences  You should be able troubleshoot unsuccessful PCR Learning Outcomes  Temperature at which half the DNA is melted (ss) is the melting temperature or Tm  Needed to determine the annealing temperature  The Tm is dependant on the GC content of the DNA molecule Melting curve of DNA Melting Temperature (Tm ) Wallace rule: Tm = 4 * (G + C) + 2 * (A + T) Bolton and McCarthy: Tm = 81.5 + 16.6 * Log [I] + 0.41 * (%GC) – 600/L The nearest neighbor method (Santalucia et.al, 1998): Melting Temperature (Tm ) • Needed to determine the annealing temperature of a probe or PCR/sequencing primer with its complementary sequence Probe/primer Target DNA Importance of the melting temperature Theoretical calculation based on experimentation: Tm = (4 x no. GC bp) +(2 x no. AT bp) Example: 5’- TGGCAAGGCATGCACATGCAT -3’ – No of As or Ts = 10 – No. of Gs or Cs = 11 Tm = (4 x no. GC bp) +(2 x no. AT bp) Tm = (4×11) + (2×10) Tm = 640C bp = base pair Melting Temperature (Tm ) Tm = (4 x no. GC bp) + (2 x no. AT bp) Ta = Tm – 5 Annealing Temperature (Ta ) 5’- TGGCAAGGCATGCACATGCAT -3’ – No of As or Ts = 10 – No. of Gs or Cs = 11 Tm = (4 x no. GC bp) +(2 x no. AT bp) Tm = (4×11) + (2×10) Tm = 640C Ta=59°C Annealing Temperature (Ta ) Primer Pair Matching Primers work in pairs – forward primer and reverse primer. Since they are used in the same PCR reaction, it shall be ensured that the PCR condition is suitable for both of them. One critical feature is their annealing temperatures, which shall be compatible with each other. The closer their Ta are, the better. 5’ CTGATCAAGTCGATGGCTTG 3’ Fw 59 C 5’ GATGGAGAGGCTTGACTGC 3’ Rv 58 C Annealing Temperature (TA ) Principles of molecular hybridisation  G ≡ C pair = 3 H-bonds  A = T pair = 2 H-bonds  If DNA helix has a high CG content it is harder to denature – A higher temperature is needed Melting temperature (Tm ) – temperature corresponding to the mid-point in the observed transition from ds to ss DNA Primer design Primer design GCACAGGATACTCCAACCTGCCTGCCCCCATGGTCTCATCCTCCTGCTTCTGGGACCTCCTGATCCTGCCCCTGGT GCTAAGAGGCAGGTAAGGGGCTGCAGGCAGCAGGGCTCGGAGCCCATGCCCCCTCACCATGGGTCAGGCTGG ACCTCCAGGTGCCTGTTCTGGGGAGCTGGGAGGGCCGGAGGGGTGTACCCCAGGGGCTCAGCCCAGATGACA CTATGGGGGTGATGGTGTCATGGGACCTGGCCAGGAGAGGGGAGATGGGCTCCCAGAAGAGGAGTG TA Reverse complement  The specificity of the primers determines the quality of the amplification reaction  Approx. 20 nt long  Avoid repetitive sequences – primers will stick to each other and therefore not take part in the PCR reaction!  Primers could hydrogen bond (anneal) to each other  Primers could bend round and anneal to themselves  Very important: 3’ end matches well as it anneals first  5’ end can be modified for other purposes Primer design  The specificity of the primers determines the quality of the amplification reaction  Approx. 20 nt long Primer design  Too short — low specificity, resulting in non-specific amplification  Too long — decrease the template-binding efficiency at normal annealing temperature due to the higher probability of forming secondary structures such as hairpins.  Avoid repetitive sequences – primers will stick to each other and therefore not take part in the PCR reaction!  Primers could hydrogen bond (anneal) to each other  Primers could bend round and anneal to themselves Primer design Avoid complementary at 3` end of primers  Avoid repetitive sequences – primers will stick to each other and therefore not take part in the PCR reaction!  Primers could hydrogen bond (anneal) to each other  Primers could bend round and anneal to themselves Primer design Current Oligo, 20-mer [68]: Current+ Oligo: the most stable 3′-dimer: 2 bp, -1.9 kcal/mol 5′ CCAGTCGTTACAAACTGAC A 3′ 3′ ACAG T CAAACATTGCTGACC 5′ :::: | | Current- Oligo: no 3′-terminal dimer formation Current+ Oligo: the most stable dimer overall: 4 bp, -4.8 kcal/mol 5′ CC A G T CGTTACAAACTGACA 3′ 3′ ACAG T C A AACATTGCTGACC 5′ | | | | :::: :::::::: Hairpin: ²G = -0.7 kcal/mol, Loop = 8 nt, Tm = 41° 5′ CC A G T CGTT A 3′ ACAG T C A AACA | | | |  Very important: 3’ end matches well as it anneals first  5’ end can be modified for other purposes Primer design 5’ GTGGATGTGGTGTCGATGGC 3’ It’s critical that the stability at 3’ end be high 5’ 5’ 3’ 3’  Primer sequences are complementary to each DNA template strand  The primers define the sequence to be amplified/cloned Priming the reaction New nucleotides add to the 3’ end of the growing strand. (DNA (Taq) polymerase) works in the 5’-3’ direction dNTPs The first cycle of PCR dNTPs The third cycle of PCR This is good:  Forensic testing  Genetic diagnosis  Pre-natal diagnosis Sensitivity of PCR Can amplify DNA from a single cell But be careful:  Contamination  Apparatus  Operator  Environment And do not forget….. Some Practical Considerations  The reaction might be unsuccessful  No product (amplicon), weak product, nonspecific product  Primer design  Template DNA (or original sample) quality (e.g. ethanol inhibits PCR) and quantity (too much or too little)  Optimisation  Inhibitors (particularly stool samples) Primer design GCACAGGATACTCCAACCTGCCTGCCCCCATGGTCTCATCCTCCTGCTTCTGGGACCTCCTGATCCTGCCCCTGGT GCTAAGAGGCAGGTAAGGGGCTGCAGGCAGCAGGGCTCGGAGCCCATGCCCCCTCACCATGGGTCAGGCTGG ACCTCCAGGTGCCTGTTCTGGGGAGCTGGGAGGGCCGGAGGGGTGTACCCCAGGGGCTCAGCCCAGATGACA CTATGGGGGTGATGGTGTCATGGGACCTGGCCAGGAGAGGGGAGATGGGCTCCCAGAAGAGGAGTG TA Primer sequence Type of primer bp n GC n AT Primer °C Ta °C Template bp 5’ TCTGGGACCTCCTGATCCTG 3’ Forward 20 12 G/C 8 A/T Tm= 64 Ta=59 238 bp 5’ 3’ Reverse 20  Avoid repetitive sequences – primers will stick to each other and therefore not take part in the PCR reaction!  Primers could hydrogen bond (anneal) to each other  Primers could bend round and anneal to themselves Primer design Primer dimers? 1 2 3 Primer design After preparing a PCR mix using MyTaq™ Red Mix, you have run a PCR using a Ta of 65 °C for 30 cycles. The gel electrophoresis results show that the expected size fragment is present in your samples but the bands intensity is very low. Increase DNA concentration in reaction Increase cycle number to 35 Optimize annealing temperature Your results expected results How can you improve the intensity of your band? 1 2 3 Monogenic disorders: Autosomal Dominant Inheritance (AD) Dr Eva Masiero (A = dominant allele; a = recessive allele/ mutated allele) AD – Genotype & Phenotype • Homozygous (recessive)= Unaffected person – asymptomatic without mutation • Heterozygous= affected person – symptomatic with heterozygotic mutation • Homozygous (dominant)= affected person – symptomatic with homozygotic mutation – RARE!!!!!! Exercise: Predict the possible genotype and phenotype of the offspring of the following couple: Mother: symptomatic with a heterozygotic mutation Father: asymptomatic without mutation A Punnett square can be used to predict genotype and phenotypes of offspring from a genetic crosses AD – Punnett Square Vertical pedigree AD – Family tree/ Pedigree Penetrance refers to a probability that a person carrying a specific mutation (genotype) will present clinical manifestations (phenotype) AD – Penetrance Complete penetrance: people with the same mutation manifest the same clinical features Incomplete penetrance: people with the same mutation don’t manifest the same clinical features AD – Disease Disease Gene/Defect Clinical Features Hypercholesterole mia LDL receptor Impaired uptake of LDL, elevated levels of LDL cholesterol, cardiovascular disease and stroke. Huntington Disease Huntingtin (HD) – CAG repeat expansion within exon 1 Disorder is characterized by progressive motor, cognitive and psychiatric abnormalities. Marfan Syndrome Fibrillin-1 gene (FBN1) encodes a microfibril-forming connective tissue protein Abnormalities of the skeleton (disproportionate tall stature, scoliosis), heart (mitral valve prolapse, aortic dilatation, dissection of the ascending aorta), pulmonary system, skin (excessive elasticity), and joints (hypermobility). Myotonic Dystrophy Myotonic Dystrophy Muscle weakness, cardiac arrhythmias, cataracts and testicular atrophy in males Neurofibromatosi s I Microdeletion at 17q11.2 involving the NF1 gene The disorder is characterized by numerous benign tumors (neurofibromas) of the peripheral nervous system Polycystic Kidney Disease Mutations in either polycystin-1 (PKD1) or polycystin-2 (PKD2) gene Multiple renal cysts, blood in urine, end-stage renal disease and kidney failure BreastandBRCA1andBRCA2 • Average onset 30-50 years • Affects 1:20 000 people of European ancestry • Affected people are normally Heterozygous (Aa) • Median survival of 24 years from diagnosis . AD – Huntington’s disease (HD) • The part of the brain most affected by HD is a at the base of the brain called basal ganglia . The major components of the basal ganglia is the striatum Part of the brain that is involved in controlling movement HD – Pathophysiology HD – Symptoms • Alterations of the CNS are the most prominent clinical features of HD Patients also suffer from: • Metabolic and immune disturbances • Skeletal-muscle wasting • Weight loss • Cardiac failure • Osteoporosis • HTT gene codes for a protein called huntingtin • Cytogenetic Location: 4p16.3 • HTT gene contains 67 exons • Huntingtin molecular mass: 348 kD • the exact function of huntingtin is unknown Huntingtin is required for early embryonic development and in neurogenesis HD – Genetic cause Huntingtin functions https://www.cell.com/neuron/pdf/S0896-6273 (16)00096-9.pdf Huntingtin regulates: • Cell Division – spindle poles during mitosis • Endocytosis, Vesicle Recycling, and Endosomal Trafficking • Transcription – regulation of Brainderived neurotrophic factor (BDNF) Neuronal survival and growth neurotransmitt er modulator neuronal plasticity, which is essential for learning and memory //ghr.nlm.nih.gov/condition/huntington-disease#genes CAG repeat expansion Huntington gene (HTT) expanded polyglutamine tract confers toxic properties in huntingtin Neural cell death HD – Genetic cause Huntington disease is a progressive brain disorder that causes uncontrolled movements, emotional problems, and loss of thinking ability (cognition). Adult-onset Huntington disease, the most common form of this disorder, usually appears in a person’s thirties or forties. Early signs and symptoms can include irritability, depression, small involuntary movements, poor coordination, and trouble learning new information or making decisions. Many people with Huntington disease develop involuntary jerking or twitching movements known as chorea. As the disease progresses, these movements become more pronounced. Affected individuals may have trouble walking, speaking, and swallowing. People with this disorder also experience changes in personality and a decline in thinking and reasoning abilities. Individuals with the adult-onset form of Huntington disease usually live about 15 to 20 years after signs and symptoms begin. A less common form of Huntington disease known as the juvenile form begins in childhood or adolescence. It also involves movement problems and mental and emotional changes. Additional signs of the juvenile form include slow movements, clumsiness, frequent falling, rigidity, slurred speech, and drooling. School performance declines as thinking and reasoning abilities become impaired. Seizures occur in 30 percent to 50 percent of children with this condition. Juvenile Huntington disease tends to progress more quickly than the adult-onset form; affected individuals usually live 10 to 15 years after signs and symptoms appear. Mutations in the HTT gene cause Huntington disease. The HTT gene provides instructions for making a protein called huntingtin. Although the function of this protein is unclear, it appears to play an important role in nerve cells (neurons) in the brain. The HTT mutation that causes Huntington disease involves a DNA segment known as a CAG trinucleotide repeat. This segment is made up of a series of three DNA building blocks (cytosine, adenine, and guanine) that appear multiple times in a row. Normally, the CAG segment is repeated 10 to 35 times within the gene. In people with Huntington disease, the CAG segment is repeated 36 to more than 120 times. People with 36 to 39 CAG repeats may or may not develop the signs and symptoms of Huntington disease, while people with 40 or more repeats almost always develop the disorder. An increase in the size of the CAG segment leads to the production of an abnormally long version of the huntingtin protein. The elongated protein is cut into smaller, toxic fragments that bind together and accumulate in neurons, disrupting the normal functions of these cells. The dysfunction and eventual death of neurons in certain areas of the brain underlie the signs and symptoms of Huntington disease. This condition is inherited in an autosomal dominant pattern, which means one copy of the altered gene in each cell is sufficient to cause the disorder. An affected person usually inherits the altered gene from one affected parent. In rare cases, an individual with Huntington disease does not have a parent with the disorder. As the altered HTT gene is passed from one generation to the next, the size of the CAG trinucleotide repeat often increases in size. A larger number of repeats is usually associated with an earlier onset of signs and symptoms. This phenomenon is called anticipation. People with the adult-onset form of Huntington disease typically have 40 to 50 CAG repeats in the HTT gene, while people with the juvenile form of the disorder tend to have more than 60 CAG repeats. s://europepmc.org/article/PMC/5495055 HD – Genetic cause 1. Aggregation of htt mutated – neuro cell toxicity 2. Transcription dysregulation – impairment of BDNF activity 3. Altered protein homeostasis – proteasome and autophagy pathway dysregulation 4. Mitochondrial dysfunction – ROS formation and impairment of ATP production 5. Altered synaptic plasticity – dysregulation of vesicles trafficking The length of the CAG repeat is the most important factor that determines age of onset and prognosis of HD. HD – Penetrance nfortunately, there is currently no cure for Huntington disease current goal of treatment is to slow down the course of the disease and improve life-style patient Medications for: movement disorders: to suppress the involuntary jerking and writhing movements psychiatric disorders: Antidepressants HD – Treatments https://link.springer.com/article/10.1007/ HD – Antisense Oligonucleotide Therapy ASOs are synthetic, modified, single-stranded DNA molecules. Single-stranded DNA typically has a short half-life due to endonucleolytic degradation pathways so ASOs must be chemically modified to enhance stability in order to effectively reach their targets [12]. In most ASOs, this is accomplished by replacing the oxygen in the phosphodiester linkage with a sulfur to create a phosphorothioate (PS) linkage that is slightly more resistant to endonuclease activity [13]. Beyond stability, PS linkages enhance ASO distribution by forming disulfide bonds with albumin, the most abundant protein in blood plasma and the cerebrospinal fluid (CSF), which transports the ASO throughout the CNS [14, 15]. Aside from benefits to stability and distribution, PS linkages can cause immune activation. However, incorporating phosphodiester (PO) linkages into the sequence creating a mixed (PS/PO) backbone can minimize this response [16, 17]. Both the Roche/IONIS and Wave ASOs have (PS/PO) mixed backbones. By chemically modifying the phosphodiesterase backbone of DNA to create PS linkages, stereochemistry is introduced, as each PS linkage becomes a chiral center. Each chiral center has the potential to yield a pair of enantiomers, 3D molecules with non-superimposable mirror image configurations denoted as Rp or Sp. Therefore, using the 2n rule to evaluate the permutability of the molecule, an ASO that is 18 base pairs in length and has 17 PS linkages (n), such as the FDA-approved spinal muscular atrophy (SMA) ASO, nusinersen, has 131,072 stereoisomeric forms that are given to patients as a racemic mixture [18]. PS/PO mixed backbones have fewer chiral centers and stereoisomers because PO linkages are achiral. Tominersen, the Roche/IONIS mixed backbone HD ASO, has 19 linkages, but since six linkages are achiral, there are only 8192 possible forms. Theoretically, each of the 8192 resulting molecules could have different pharmacologic properties. For instance, in ASOs, comparatively speaking, the Rp stereoisomer is expected to be favored by RNase H for cleavage while the Sp configuration offers increased stability [19,20,21,22]. Together the Rp and Sp linkages seem to create a functionally balanced molecule. Tominersen is stereorandom—a mixture of both Rp and Sp linkages. Historically, the safety and potency of stereorandom drugs has been called into question. Although some stereoisomers may perform similarly therapeutic functions, there are others that are less than complementary, ranging from biologically inactive to highly toxic molecules [23, 24]. ASOs yield potentially hundreds of thousands of different stereoisomers making it technically prohibitive to use separation techniques to isolate one pure ASO molecule. In lieu of stereoisomer separation, Wave Life Sciences has developed stereocontrolled oligonucleotide synthesis with iterative capping and sulfurization (SOSICS) [22]. SOSICS grants control over the stereochemistry of each PS linkage during molecule production, allowing Wave to synthesize a single stereopure ASO molecule [25]. While this stereopure synthesis method eliminates the risk of enantiomeric impurities, controlling chirality influences drug activity [26]. Stereopure molecules composed of only Sp linkages demonstrate improved stability [22], but are significantly less potent [20]. RNase H has been reported to favor Rp linkages [19] but molecules composed of only Rp linkages do not show a significant increase in potency [20]. Controlling stereochemistry may provide enhanced stability, RNase H activity, or tolerability but the most potent ASO molecule may not be the most stable, potentially requiring a balance to be sought. Regardless of stereochemistry, PS-modified ASOs have relatively low RNA binding affinity and are still substrates for endonucleases, limiting overall drug potency. ASO bases can be modified at the 2′ carbon of the sugar ring to enhance RNA binding affinity and improve stability [27]. Nucleosides containing these 2′ sugar modifications are not substrates for endonucleases so an ASO composed completely of 2′ modified sugars would not recruit RNase H. Therefore, ASOs that induce target degradation are designed as gapmers—chimeric oligonucleotides composed of the DNA sequence ‘gap’ that is susceptible to RNaseH-mediated degradation and the flanking chemically modified RNA wings, providing stability and affinity [28].The first 2′ sugar modification was the 2′-O-methyl (2′-O-Me), which increases the melting temperature of the molecule indicating improved stability. The Wave ASOs are 2′-O-Me gapmers, as the core sequence is flanked by 2′ sugar moieties with 2′-O-Me modifications and mixed PS/PO linkages [29]. Subsequent modifications, such as the 2′-O-methoxethyl (MOE) developed by IONIS Pharmaceuticals, have even higher RNA binding affinity and proved to be more stable than 2′-O-Me modifications [30]. The Roche/IONIS ASO is a MOE gapmer, as its core sequence is flanked by 2′ sugar moieties with MOE modifications and mixed PS/PO linkages [31]. 3 Targeting HD is an autosomal dominantly inherited disease, thus the causative mtHTT gene is the first logical therapeutic target. The HTT gene is haplosufficient, meaning that, while complete inactivation of HTT is embryonically lethal [33,34,35], the deletion of one copy of HTT does not cause an overt abnormal phenotype [36]. This suggests allele-selective lowering of mtHTT as a potential treatment for HD. This would typically be achieved by targeting the disease-causing mutation for suppression. However, the CAG tract that is expanded to cause HD is present in all HTT genes as well as many other genes throughout the genome [37]. Targeting the expanded CAG tract, therefore, has the potential for off-target hybridization—where the ASO binds to a similar sequence not within the gene of interest. In lieu of targeting the mutation selectively, a nonselective approach was adopted to partially suppress both wild-type huntingtin (wtHTT) and mtHTT. In preclinical studies, 50% suppression of mtHTT is sufficient to provide benefit [38] and total HTT can be lowered by 50% without overt phenotype, [33], suggesting that appropriately dosed nonselective ASOs could provide a potentially safe and effective therapy. Nonselective ASOs, like the Roche/IONIS ASO, target HTT, indiscriminately binding to both wtHTT and mtHTT transcripts, and degrade a portion of each . While this nonselective strategy was widely pursued, population genetics studies identified single nucleotide polymorphisms (SNPs) that are in linkage disequilibrium with the CAG expansion (HD-SNPs), providing alternate targets for allele-selective mtHTT suppression [39, 40]. Human fibroblast lines were screened and selected for heterozygosity of HD-SNPs and subsequently used to screen potential allele-selective ASOs. This led to the development of a SNP-targeted ASO that discriminated and lowered fibroblastic mtHTT mRNA by a 5-fold difference compared with the wtHTT [41]. Single base-pair mismatches alter RNase H cleavage patterns, so ASOs were chemically modified to reduce RNase H activity outside the desired cleavage site, improving single nucleotide discrimination from 5-fold to 100-fold [42]. ASO selectivity was demonstrated in vivo using humanized HD mice that are heterozygous for human mtHTT and wtHTT ld[]dhllhbfifhhldfdbhldfildh DNA mutations – causes M u t a ti o n Spontaneo us Induced Physical Mutagen Chemical MutagenBiological Mutagen DNA Replication error Point mutation Frame shift mutation Spontaneous chemical changes Deaminati on Depurinati on/ Depyrimida tion • It can be either point mutations or frameshift mutation • Point Mutations: • Incorrect base pairs due to spontaneous mutation in the cell • G base pair with T and a C base pair with A • Only mismatches uncorrected before the next replication will lead to mutations Spontaneous mutation -Mistakes durinreplication • Frame Shift: • Insertions and deletions can occur spontaneously • Deletion: • DNA loops out from the template strand • DNA polymerase skips the loop-out base • Insertion: • DNA loops out from the new template strand • DNA polymerase adds a new bSpontaneous mutation -Mistakes durinreplication Replication slippage Cleavage of the bond between purine base and the deoxyribose sugar Alteration of DNA Spontaneous chemical mutation – Depurination Spontaneous chemical mutation – Deamination Removal of an amino group (NH2 ) from a base: • Deamination of C → U: Unpaired: A will be incorporated into the new DNA strand resulting in the conversion of GC pair to TA • Deamination of 5-meC → T: No repair mechanism: conversation of CG to TA DNA mutations – causes M u t a ti o n Spontaneo us Induced Due to replication error Point mutation Frame shift mutation Spontaneous lesion Deamina tion Depurinati on/ Depyrimida tion Physical Mutagen – Radiation Chemical Mutagen Biological Mutagen Induced mutations are alterations of DNA sequence after the exposure with physical and chemical agent MUTAGEN Xrays DNA mutation – Induced mutation Induced mutation – Biological agents 1. Virus– Virus DNA may be inserted into the genome which disrupts genetic function. E.g. Rous sarcoma virus, Human immunodeficiency virus 2. Bacteria– some bacteria cause inflammation – increase ROS production that can provoke DNA damage and DNA breakage. E.g: Helicobacter pylori • Ionizing (e.g. X – rays): • X rays form ions that can break covalent bonds – sugar-phosphate backbone DNA • It causes chromosomal abnormalities. Induced mutation – Physical mutagensRadiation • Ultraviolet (UV) causes photochemical changes in the DNA • Formation of dimers between adjacent pyrimidines, commonly thymine • Unpair: unusual pairing produces a bulge in the DNA strand – inhibition of replication Induced mutation – Physical mutagensRadiation Molecule of the Month: Thymine Dimers Ultraviolet light damages our DNA, but our cells have ways to correct the damage A small piece of DNA with a thymine dimer (magenta). A small piece of DNA with a thymine dimer (magenta). Download high quality TIFF image Summer is here, and we’re all heading outdoors to enjoy the sun. But remember to take your sunscreen, since too much sunlight can damage your cells. Small doses of sunlight are needed to create vitamin D, but larger doses attack your DNA. Ultraviolet light is the major culprit. The most energetic and dangerous wavelengths of UV light, termed UVC, are screened out (at least for now) by the ozone in the upper atmosphere. However, the weaker UV light, termed UVA and UVB, passes through the atmosphere and is powerful enough to cause chemical changes in the DNA. Dangerous Dimers Ultraviolet light is absorbed by a double bond in thymine and cytosine bases in DNA. This added energy opens up the bond and allows it to react with a neighboring base. If the neighbor is another thymine or cytosine base, it can form a covalent bond between the two bases. The most common reaction is shown here: two thymine bases have formed a tight thymine dimer, with two bonds gluing the bases together. The upper image is from PDB entry 1n4e and the close-up picture at the bottom is from PDB entry 1ttd . This is not a rare event: every second you are in the sun, 50 to 100 of these dimers are formed in each skin cell! Problems with Polymerases These dimers are awkward and form a stiff kink in the DNA. This causes problems when the cell needs to replicate its DNA. DNA polymerase has trouble reading the dimer, since it doesn’t fit smoothly in the active site. TT dimers like the ones shown here are not the major problem, since they are usually paired correctly with adenine when the DNA is replicated. But CC dimers do not fare as well. DNA polymerase often incorrectly pairs adenine with them instead of guanine, causing a mutation. If this happens to be in an important gene that controls the growth of cells, such as the genes for Src tyrosine kinase or p53 tumor suppressor, the mutation can lead to cancer. Error Control We spend a lot of time in the sun, so it will come as no surprise that we have a powerful mechanism for correcting these problems. Our cells use a process called nucleotide excision repair, which requires the concerted effort of a large collection of proteins that recognize the corrupted bases, clip out the section of DNA with the error, and then build a new copy of the damaged area. Other organisms have additional correction mechanisms. For instance, the enzyme on the left (PDB entry 1vas ) is an endonuclease that clips out the damaged bases, making the site available for repair. Surprisingly, this endonuclease doesn’t recognize the thymine dimer directly. You can see in this picture that the thymine dimer (colored magenta) doesn’t touch the enzyme at all. Instead, the enzyme recognizes one of the adenines that is paired with the dimer. Since the base pair is weakened by the contorted shape of the dimer, the adenine is easily flipped out and bound to a pocket in the enzyme. The enzyme on the right (PDB entry 1tez ) is a photolyase that directly breaks the bonds connecting the dimer, correcting the error in place. Ironically, photolyases use visible light to power this process. This structure captures the DNA after the thymine dimer has been fixed. Notice that the two thymine bases (colored magenta) are flipped out of the normal DNA helix and are bound in a pocket on the enzyme surface. Most DNA polymerases have a hard time replicating DNA with pyrimidine dimers. The enzyme on the left, from PDB entry 1rys , is an exception: it is designed to read through damaged DNA. It has a loose active site, so it can easily accommodate the stiff thyminedimerHoweverthisopenactivesitemakestheenzymeratherpronetoerrorsAmoretypicalDNApolymeraseisshownontherightfromPDBPhysical mutagens: thymine dimers formation Chemical mutagens alter the pairing properties and structure of DNA They can be natural and synthetic substance 1. Base analogues: any chemical that has a similar structure (i.e. is analogous) to one of the purine or pyrimidine bases in DNA or RNA. 2. Alkylating agents: modify the normal base by adding alkyl group Induced mutation – Chemical agent //biotechkhan.wordpress.com/tag/base-analogue/ Base analogs • The base analogs are similar to the base normally found in DNA • Substitution of a base analogue will result in altered base pairings Induced mutation – Chemical agent Alkylating agents • Alkylating agents are compounds adding an alkyl group to the guanine base of the DNA molecule, preventing the strands of the double helix from linking Instability of double helix stop replication (the cells can no longer divide) • Alkylating agents are used to treat several cancers Induced mutation – Chemical agent https://blog.crownbio.com/dna-damage-response DNA repair mechanisms DNA repair mechanisms – DNA proofreadin• DNA polymerase proofreading corrects most of the mismatched base pairs • 3’ to 5’ Exonuclease activity of DNA polymerase removes the wrong nucleotide and the replication can move forward Backup system for repairing errors escape from proofreading ability of DNA polymerase New DNA strand presents a mismatch base pairs Nicks directs mismatch proofreading systems to the appropriate strand A few base pairs are removed DNA polymerase fills the gap with the correct nucleotide DNA ligase seals the gap DNA repair mechanisms – DNA mismatch repair system Glycosylases enzymes detect and remove a specific kind of damaged base AP site Formation of AP sites (apurinic/apyrimidinic site) DNA polymerase fills the gap with the correct nucleotide DNA ligase seals the gap Example of spontaneous mutation repair byBERSpontaneous mutation DNA repair mechanisms – Base Excision Repair system (BER) Nucleotide excision repair recognise pyrimidine dimer or distortion in the DNA Recognition of the damage removal of a short single-stranded DNA segment that contains the lesion. DNA polymerase uses as template the undamaged single-stranded DNA to synthesize a short complementary sequence Final ligation to form a double stranded DNA is carried out by DNA ligase. Structural distortion = signal Induced mutation DNA repair mechanisms – Nucleotide Excision Repair system (NER) Disorders of the nervous system may involve the following: Vascular disorders, such as stroke, transient ischemic attack (TIA), subarachnoid hemorrhage, subdural hemorrhage and hematoma, and extradural hemorrhage Infections, such as meningitis, encephalitis, polio, and epidural abscess Structural disorders, such as brain or spinal cord injury, Bell’s palsy, cervical spondylosis, carpal tunnel syndrome, brain or spinal cord tumors, peripheral neuropathy, and Guillain-Barré syndrome Functional disorders, such as headache, epilepsy, dizziness, and neuralgia Degeneration, such as Parkinson disease, multiple sclerosis, amyotrophic lateral sclerosis (ALS), Huntington chorea, and Alzheimer disease Signs and symptoms of nervous system disorders The following are the most common general signs and symptoms of a nervous system disorder. However, each individual may experience symptoms differently. Symptoms may include: Persistent or sudden onset of a headache A headache that changes or is different, Loss of feeling or tingling, Weakness or loss of muscle strength Loss of sight or double vision, Memory loss, Impaired mental ability Lack of coordination Muscle rigidity,Tremors and seizures Back pain which radiates to the feet, toes, or other parts of the body Muscle wasting and slurred speech New language impairment (expression or comprehension) Chemic al assault Mishaps of replication fork Fracture double strand DNA Fragmentation of chromosomes Loss of genes radiation Damage of double strand DNA • Quick stick of two broken strands end together – two broken ends of the DNA are simply glued back together • Cause the lost of a few nucleotides at the cut site Figure 6.27 essential cell biology 4th Introduction of a new mutation Nonhomologous end joining system Homologous DNA strand is used as template to repair the two broken DNA strands NO introduction of a new mutation Homologous recombin What does DNA have to do with cancer? Cancer occurs when cells divide in an uncontrolled way, ignoring normal “stop” signals and producing a tumor. This bad behavior is caused by accumulated mutations, or permanent sequence changes in the cells’ DNA. Replication errors and DNA damage are actually happening in the cells of our bodies all the time. In most cases, however, they don’t cause cancer, or even mutations. That’s because they are usually detected and fixed by DNA proofreading and repair mechanisms. Or, if the damage cannot be fixed, the cell will undergo programmed cell death (apoptosis) to avoid passing on the faulty DNA. Mutations happen, and get passed on to daughter cells, only when these mechanisms fail. Cancer, in turn, develops only when multiple mutations in division-related genes accumulate in the same cell. In this article, we’ll take a closer look at the mechanisms used by cells to correct replication errors and fix DNA damage, including: Proofreading, which corrects errors during DNA replication Mismatch repair, which fixes mispaired bases right after DNA replication DNA damage repair pathways, which detect and correct damage throughout the cell cycle Proofreading DNA polymerases are the enzymes that build DNA in cells. During DNA replication (copying), most DNA polymerases can “check their work” with each base that they add. This process is called proofreading. If the polymerase detects that a wrong (incorrectly paired) nucleotide has been added, it will remove and replace the nucleotide right away, before continuing with DNA synthesis 1 1 start superscript, 1, end superscript. Proofreading: 1. DNA polymerase adds a new base to the 3′ end of the growing, new strand. (The template has a G, and the polymerase incorrectly adds a T rather than a C to the new strand.) 2. Polymerase detects that the bases are mispaired. 3. Polymerase uses 3′ to 5′ exonuclease activity to remove the incorrect T from the 3′ end of the new strand. Proofreading: DNA polymerase adds a new base to the 3′ end of the growing, new strand. (The template has a G, and the polymerase incorrectly adds a T rather than a C to the new strand.) Polymerase detects that the bases are mispaired. Polymerase uses 3′ to 5′ exonuclease activity to remove the incorrect T from the 3′ end of the new strand. Mismatch repair Many errors are corrected by proofreading, but a few slip through. Mismatch repair happens right after new DNA has been made, and its job is to remove and replace mis-paired bases (ones that were not fixed during proofreading). Mismatch repair can also detect and correct small insertions and deletions that happen when the polymerases “slips,” losing its footing on the template 2 2 squared. How does mismatch repair work? First, a protein complex (group of proteins) recognizes and binds to the mispaired base. A second complex cuts the DNA near the mismatch, and more enzymes chop out the incorrect nucleotide and a surrounding patch of DNA. A DNA polymerase then replaces the missing section with correct nucleotides, and an enzyme called a DNA ligase seals the gap 2 2 squared. Many errors are corrected by proofreading, but a few slip through. Mismatch repair happens right after new DNA has been made, and its job is to remove and replace mis-paired bases (ones that were not fixed during proofreading). Mismatch repair can also detect and correct small insertions and deletions that happen when the polymerases “slips,” losing its footing on the template 2 2 squared. How does mismatch repair work? First, a protein complex (group of proteins) recognizes and binds to the mispaired base. A second complex cuts the DNA near the mismatch, and more Base excision repair is a mechanism used to detect and remove certain types of damaged bases. A group of enzymes called glycosylases play a key role in base excision repair. Each glycosylase detects and removes a specific kind of damaged base. For example, a chemical reaction called deamination can convert a cytosine base into uracil, a base typically found only in RNA. During DNA replication, uracil will pair with adenine rather than guanine (as it would if the base was still cytosine), so an uncorrected cytosine-to-uracil change can lead to a mutation 5 5 start superscript, 5, end superscript. To prevent such mutations, a glycosylase from the base excision repair pathway detects and removes deaminated cytosines. Once the base has been removed, the “empty” piece of DNA backbone is also removed, and the gap is filled and sealed by other enzymes 6 6 start superscript, 6, end superscript. Nucleotide excision repair is another pathway used to remove and replace damaged bases. Nucleotide excision repair detects and corrects types of damage that distort the DNA double helix. For instance, this pathway detects bases that have been modified with bulky chemical groups, like the ones that get attached to your DNA when it’s exposed to chemicals in cigarette smoke 7 7 start superscript, 7, end superscript. Nucleotide excision repair is also used to fix some types of damage caused by UV radiation, for instance, when you get a sunburn. UV radiation can make cytosine and thymine bases react with neighboring bases that are also Cs or Ts, forming bonds that distort the double helix and cause errors in DNA replication. The most common type of linkage, a thymine dimer, consists of two thymine bases that react with each other and become chemically linked 8 8 start superscript, 8, end superscript. In nucleotide excision repair, the damaged nucleotide(s) are removed along with a surrounding patch of DNA. In this process, a helicase (DNA-opening enzyme) cranks open the DNA to form a bubble, and DNA-cutting enzymes chop out the damaged part of the bubble. A DNA polymerase replaces the missing DNA, and a DNA ligase seals the gap in the backbone of the strand 9 9 start superscript, 9, end superscript. Double-stranded break repair Some types of environmental factors, such as high-energy radiation, can cause double-stranded breaks in DNA (splitting a chromosome in two). This is the kind of DNA damage linked with superhero origin stories in comic books, and with disasters like Chernobyl in real life. Double-stranded breaks are dangerous because large segments of chromosomes, and the hundreds of genes they contain, may be lost if the break is not repaired. Two pathways involved in the repair of double-stranded DNA breaks are the non-homologous end joining and homologous recombination pathways. In non-homologous end joining, the two broken ends of the chromosome are simply glued back together. This repair mechanism is “messy” and typically involves the loss, or sometimes addition, of a few nucleotides at the cut site. So, non-homologous end joining tends to produce a mutation, but this is better than the alternative (loss of an entire chromosome arm) 10 10 start superscript, 10, end superscript. In homologous recombination, information from the homologous chromosome that matches the damaged one (or from a sister chromatid, if the DNA has been copied) is used to repair the break. In this process, the two homologous chromosomes come together, and the undamaged region of the homologue or chromatid is used as a template to replace the damaged region of the broken chromosome. Homologous recombination is “cleaner” than non-homologous end joining and does not usually cause mutations 11 11 start superscript, 11, end superscript. Evidence for the importance of proofreading and repair mechanisms comes from human genetic disorders. In many cases, mutations in genes that encode proofreading and repair proteins are associated with heredity cancers (cancers that run in families). For example: Hereditary nonpolyposis colorectal cancer (also called Lynch syndrome) is caused by mutations in genes encoding certain mismatch repair proteins 12 , 13 12,13 start superscript, 12, comma, 13, end superscript. Since mismatched bases are not repaired in the cells of people with this syndrome, mutations accumulate much more rapidly than in the cells of an unaffected person. This can lead to the development of tumors in the colon. People with xeroderma pigmentosum are extremely sensitive to UV light. This condition is caused by mutations affecting the nucleotide excision repair pathway. When this pathway doesn’t work, thymine dimers and other forms of UV damage can’t be repaired. People with xeroderma pigmentosum develop severe sunburns from just a few minutes in the sun, and about half will get skin cancer by the age of 10 1010 unless they avoid the sun 14 14 start superscript, 14, end superscript. 1. Deaminatio n 2. Depurinatio n a) Removal of the amine group convert cytosine base in uracil – nucleotide pairing alteration b) Removal of the purine base leads to the formation of apurinic site in the DNA strand – DNA structure alterationMatch the correct type of spontaneous mutation with the correct definition Exercise G e n e ti c D i s e a s e Monogenic Polygenic Multifactorial https://cardiovascularultrasound.biomedcentral.com/articles/10.1186/1476-7120-6-62 https://www.genome.gov/Health/Genomics-and-Medicine/Polygenic-risk-scores Heritable hypertrophic and dilated cardiomyopathies are monogenic diseases, caused by mutations in key genes that lead to the absence or abnormality of myocardial proteins [5]. Disease-causing gene mutations have been identified in approximately two-thirds of cases of hypertrophic cardiomyopathy (HCM) and about 50% of idiopathic dilated cardiomyopathy (DCM). Various types of mutations can occur in DNA, including non-sense (stop codons), missense mutations (causing aminoacid substitution) and splice-site. Mostly, newly detected mutations for heritable cardiovascular disorders are missense. For these mutations, it is difficult to establish their pathogenicity, unless specific functional test are available. Presently, pathogenicity is presumed when the substitution affects a very conserved sequence through evolution, or it was reportedly associated to disease in independent patients. The accurate reconstruction of family history is crucial element for diagnosis of genetic cardiomyopathy [6]. The family history should encompass at least 3 generations with a careful and complete history about the family members, including demographic and medical information [7]. The family history may provide additional relevant information, such as age of onset and penetrance, and help to identify the patterns of inheritance Polygenic Traits • Polygenic trait refers to a trait that is controlled by multiple non-allelic genes • Examples of polygenic traits: height, skin color, hair color, and eye color One trait Ge ne C Ge ne A Ge ne B Polygenic diseases • Polygenic disease (or polygenic disorder) results from the effects of the combined action or interaction of multiple genes • Most polygenic diseases are determined by the interactions of several genes and environmental factors ⇨ Multifactorial disease • It does not follow a Mendelian inheritance pattern • Polygenic conditions occur more frequently than monogenic diseases. • Birth defects such as neural tube defects and cleft palate • Cancers of the breast, ovaries, bowel, prostate, and skin • High blood pressure and high cholesterol • Diabetes mellitus type 2 • Alzheimer disease • Schizophrenia • Bipolar disorder • Arthritis • Osteoporosis • Skin conditions such as psoriasis, moles, and eczema • Asthma and allergies • Multiple sclerosis and other autoimmune disorders Multifactorial Diseases – types s://www.mdpi.com/2073-4425/6/1/87 Diabetes mellitus type 2 T2DM • Diabetes refers to a group of metabolic diseases characterized by hyperglycemia resulting from defects in insulin secretion, insulin action, or both • Type 1 Diabetes Mellitus (T1DM):5– 10% of all cases of diabetes • T2D is the most common form of the disease (90–95% of all cases) • T2D is a multifactorial disease: genetic + environmental factors https://www.researchgate.net/publication/ 335684432_Understanding_glycaemic_control_and_current_approaches_for_screening_antidiabetic_natural_products_fro idbddiillT2DM Type 2 Diabetes Mellitus is a complex metabolic disorder with negative consequence on longevity and quality of life. With changing lifestyles, the prevalence of diabetes is expected to rise, and there is an increasing need for novel and alternative therapies that can help manage diabetes more efficiently, affordably, and with less side-effects. Plants have been used in traditional medicinal sys-tems for successful treatment of diabetes and have great. Page 28 of 35Lankatillake et al. Plant Methods (2019) 15:105 potential as valuable alternative antidiabetic therapies   and novel drug leads. e search for antidiabetic plants and natural products rely on testing for known antihy-perglycaemic  mechanisms of action of current medi-cations prescribed for diabetes. Several experimental models including animals, isolated tissue, immortalised cell lines, and biochemical assays are utilised for screen-ing plants for antidiabetic activity. In particular, screen-ing plant extracts for inhibition of the carbohydrases α-amylase and α-glucosidase using computer-aided molecular docking studies and biochemical assays have become popular approaches due to their amenability to highthroughput screening. Modern technologies such as HR LC–MS, MSn, and NMR offer powerful tools for the detailed analysis of plant extracts to identify novel bioac-tive molecules which can be developed into novel drugs for diabetes management. e complex, multi-organ nature of diabetes necessi-tates the use of multiple experimental models as no  single model can accurately portray all the pathological aspects of the disease. e availability of a range of experimen-tal  models makes it possible to select one that is appro-priate for the aims of a study. Although there are several avenues for exploring antidiabetic properties of plants, there is a lack of standard protocols for most of the assays which makes it difficult to compare results between stud-ies. Development of standardised testing methods for known therapeutic targets of diabetes are necessary and beneficial.Abbreviations1D NMR: one-dimensional nuclear magnetic resonance; 2D NMR: two-dimensional nuclear magnetic resonance; Akt: protein kinase B (also abbrevi-ated as PKB); ALX: alloxan; BCAA : branched-chain amino acids; cAMP: cyclic adenosine monophosphate; COSY: correlation spectroscopy; CVD: cardiovascular disease; DART™: Direct Analysis in Real Time; DIO: diet-induced obesity; DKA: diabetic ketoacidosis; DKD: diabetic kidney disease; DPP-4: dipeptidyl peptidase-4; DNP: dynamic nuclear polarisation; EI: electron ionisation; ELISA: enzymelinked immunosorbent assay; ESI: electro-spray ionisation; FT-ICR MS: Fourier transform-ion cyclotron resonance mass spectrometry; G6Pase: glucose 6-phosphatase; GC–MS: gas chromatography–mass spectrometry; GDM: gestational diabetes mellitus; GIP: glucose-dependent insulinotropic peptide; GK rat: Goto-Kakizaki rat; GLP-1: glucagon-like peptide 1; GLUT4: glucose transporter type 4; GPR119: G protein-coupled receptor 119; GTP: guanosine triphosphate; GSH: glutathione; GSV: GLUT4 storage vesicle; HbA1c: glycosylated haemoglobin; HPLC: high performance liquid chromatography; HR LC–MS: high resolution liquid chromatography–mass spectrometry; HSD: high sugar diet; HSQC: heteronuclear single-quantum correlation; INS-R: insulin receptor; IR: insulin resistance; IRS-1: insulin receptor substrate 1; JCR/LA-cp rat: James C Russell/LA corpulent rat; Ki: theoretical inhibition constant; KK AY mouse: KK yellow obese mouse; KKmouse:KuoKundomouse;LC–MS:liquidchromatography–massspectrometry;LLC:liquid–liquidextraction;MS:mass https://www.mdpi.com/2073-4425/6/1/87 Genome-wide association studies (GWAS) have shown more than 100 genes susceptible to DM2 most related to: • action of insulin • insulin secretion T2DM – Genetic marks https://www.researchgate.net/publication/328344689_Polymorphisms Genome-wide association studies (GWAS) • A genome-wide association study is a research approach that aims to identify associations of genotypes with phenotypes in a particular disease • It is based on wholegenome microarrays and NGS-based wholegenome sequencing methods https://www.mdpi.com/1422- 0067/22/21/11652T2DM – Epigenetic marks • changes in DNA methylation profiles contribute to T2D onset and evolution • changes in DNA methylation occur in: • Pancreatic islets: • Altered insulin secretion • Altered β cell survival • Skeletal muscle (SK): • Altered mass and regeneration • Altered metabolism and insulin sensitivity • Adipose tissue (AT): • Impact on lipogenesis and adipokine secretion • Altered metabolism and insulin sensitivity • Liver • CAMK1D is a member of the Ca2+/calmodulin-dependent protein kinase family ⇨ activates CREBdependent gene transcription • CAMK1D may have a role in beta cell insulin secretion and survival rate ⇧ CREB-dependent gene transcription ⇧ insulin ⇩ apoptosis β cells T2DM – Epigenetic marks https://www.nature.com/articles/s41467-018- early-life exposure to various adverse environmental factors may result in an increased risk of developing T2D in adult life 50% dietary restriction (DR) throughout gestation ⇨ ⇨ reduced beta-cell mass epigenetics impairment of key genes involved in β-cell development. T2DM – Prenatal factors & Epigenetics DNA mutations – definition Permanent changes in the DNA sequence that affect genetic information Mutations may or may not affect the phenotype Normal Gene sequence Mutated RNA seq mutation mutation Faulty protein DNA mutations Mutated Gene sequence mutation Mutated amino acid sequence How common are the mutations? • Mutation occurs at a frequency of about 1 in every 1 billion base pairs • Everybody has about 6 mutations in each cell in their body If we have so many mutations why don’t we look weird????? Because most are harmless  No effect mutations: cells have very sophisticated machinery for repairing mutations very quickly Beneficial mutation: Some mutations may cause a beneficial trait  Main sources of genetic variants in population  Harmful mutations: lead to genetic disorder (down syndrome; Sickle cell anaemia; cystic fibrosis; cancer) DNA mutations – good or bad? DNA mutations – Acquired vs Inherited Acquired (somatic mutation): – Affect somatic cells – Occurs at some time during person’s life – It cannot be passed from generation to generation – Examples: cancer Inherited: – Affects germ cell line (eggs or sperm) – Occurs during the reproductions – Presents throughout person’s life in every cells in the body – it can be passed from generation to generation – Examples: cystic fibrosis, Phenylketonuria, Gaucher disease Mutation Small-scale mutation – Gene Mutation (microalteration) Large-scale mutationChromosome abnormalities (macroalteration) Chromosome abnormalities (Changing the number) Chromosome abnormalities (Changing the structure) Deletion Inversion Translocation Duplication DNA mutations – types Point Mutation Silent mutation Nonsense mutation Missense mutation Deletion Insertion Mutation Small-scale mutation – Gene Mutation (microalteration) DNA mutations – types Point Mutation Silent mutation Nonsense mutation Missense mutation Deletion Insertion Frameshift mutation Single nucleotide polymorphisms (SNPs) • SNPs are single-nucleotide substitutions of ONE base for another. • SNPs do not always affect a protein functions. • SNPs are divided in 2 groups: 1. Linked SNPs 2. Causative SNPs Point mutation – SNPs Point mutation – SNPs Substitution Normal gene sequence Nucleotide substitution could be: Transition: substitution of: • purines ↔ purines (A ↔ G) • pyrimidines ↔ pyrimidines (C ↔ T) Transversion: substitution of: • purines ↔ pyrimidines • pyrimidines ↔ purines Normal gene sequence Codon substitution could be: Synonymous substitution: the mutated codon translate for the same amino acid as the original codon Nonsynonymous substitution: the mutated codon does not translate (encode) for the same amino acid. Point mutation – SNPs Substitution Genetic code degeneracy TGC ACA CTT TGC ACG CTT ACG UGU GAA ACG UGC GAA Thr –Cys – Glu Thr – Cys – Glu DNA mRNA protein Normal Mutant The base substitution results in a change of the codon that translates for the SAME amino acid as the original codon DNA mutations – Silent mutation TGC ACA CTT TGC ACC CTT ACG UGU GAA ACG UGG GAA Thr –Cys – Glu Thr – Trp – Glu DNA mRNA protein Normal Mutant The base substitution results in a change of the codon that translates for a DIFFERENT amino acid. DNA mutations – Missense mutation DNA mutations – Missense mutation What is the effect of the mutation on the haemoglobin protein function? TGC ACA CTT TGC ACT CTT ACG UGU GAA ACG UGA GAA Thr –Cys – Glu Thr – STOP DNA mRNA protein Normal Mutant The base substitution results in a change of the codon that translates for a DIFFERENT amino acid – STOP CODON amino acid. DNA point mutations – Nonsense mutation DNA point mutations – Nonsense mutation Identified a genetic disorder associated with a non-sense mutation: Duchenne muscular Dystrophy, cystic fibrosis, spinal muscular atrophy, neurologic disorders. • Silent mutation: no effect on protein function • Missense mutation: may or may not have an effect on the protein function • Nonsense mutation: results in absence or truncated protein Often lethal at the embryonic stage Substitution mutations – effect on the proteins function • Changes the “reading frame” of a nucleotide sequence • Two types: •Insertion •Deletion • Proteins are built incorrectly Point mutation – Frameshift mutation AGC CGA TCC UCG GCU AGG Ser Ala Arg 1. Normal AGC CCG ATC C UCG GGC UAG G Ser Gly Stop 2. Insertion Insertion mutation is the addition of one or more nucleotides in a DNA sequence. Frameshift mutation – Insertion AGC CGA TCC UCG GCU AGG Ser Ala Arg 1. Normal AGC GAT CC UCG CUA GG Ser Leu 3. Deletion Deletion mutation is the loss of one or more nucleotides in a DNA sequence. Frameshift mutation – Deletion no function protein Deletion Insertion Frameshift mutation: effects on the protein function Identified a genetic disorder associated to the following DNA frameshift mutation Frameshift Mutation Genetic disease Mutation Insertion Myotonic dystrophy Fragile x syndrome Deletion Cat cry syndrome Cystic fibrosis Point mutation – Frameshift mutation https://www.researchgate.net/publication/311338547_Epigenetics_from_the_past_to_the_present pigenetics Definitions • Epi is the Greek prefix meaning “on top of or in addition to genetics.” • Chemical modification of DNA structure that changes the pattern of gene expression WITHOUT alternating DNA sequence Gene Environm ent Gene expressio n M e dicin e genetics – chromatin role – RECAP • DNA is packed into a structure called CHROMATIN • Chromatin organises gene to be accessible for transcription, replication and repair • Epigenetics change the structure of the chromatin in order to allow or not gene expression https://www.researchgate.net/publication/263097109_Altered_Histone_Modifications_in_Glioma sgenetic – chromatin modifications pigenetic – modifications searchgate.net/publication/355549121_Epigenetic_Dysregulations_in_Merkel_Cell_Polyomavirus-Driven_Merkel_Cell_Carcinoma https://www.news-medical.net/life-sciences/What-is-DNA-Methylation.aspx https://www.nature.com/articles/npp2012112 pigenetic – DNA methylation 1. methyl group (-CH3) is added to the fifth carbon atom of a cytosine ring 2. DNA methylation predominantly occurs in CpG dinucleotides (CpG islands) 3. CpG Island is a DNA sequence (200bp) in the promoter regions with a high quantity of the nucleotides G and C next to one TF 70% to 80% of CpG island are unmethylated: activation of Gene Expression TF pigenetic – DNA methylation ? What is the name and the mechanism of action of the enzyme involved in the demethylation of DNA? genetic – DNA methylation reaction DNMT: DNA methyltransferases DNMT1: Maintenance of DNA methylation following the differentiation SAM: S-adenyl DNMT3a & DNMT3b are methionine responsible for establishing NEW DNA methylation patterns during embryogenesis and setting up genomic imprints during germ cell development DNA methylation Genom ic imprin ting gene expression regulation (prooncogene, tissue specific) Xchromoso me inactivatio n Embryoni c develop ment pigenetic – DNA methylation enetic – DNA Methylation and Developm igenetic – Histone modification • It is a reversable post-translational modification of histone proteins tails • The principal covalent modifications are:  acetylation,  methylation,  phosphorylati on,  ubiquitination,  SUMOylation https://www.researchgate.net/publication/263097109_Altered_Histone_Modifications_in_Glioma igenetic – Histone modifications http://www.crystalgenomics.com/en/clinical/anticancer.html?ckattempt=1 https://www.whatisepigenetics.com/histone-modifications/2/ genetic – Histone modifications enzymes On the other hand, arginine methylation of histones H3 and H4 promotes transcriptional activation and is mediated by a family of protein arginine methyltransferases (PRMTs). There are 9 types of PRMTs found in humans but only 7 members are reported to methylate histones. They can mediate mono or dimethylation of arginine residues. Based on the position of the methyl group addition, PRMTs can be classified into type I (CARM1, PRMT1, PRMT2, PRMT3, PRMT6, and PRMT8) and type II (PRMT5 and PRMT7). Type II PRMTs are found to be strongly implicated in diseases like cancer.1 For example, PRMT5 plays a role in the repression of certain tumor suppressor genes such as RB tumor suppressors while PRMT7 overexpression is observed in breast cancer. Detection of activity and inhibition of type II PRMTs as well as other HMTs would be important in elucidating mechanisms of epigenetic regulation of gene activation and silencing, as well as benefiting cancer diagnostics and therapeutics. Histone demethylation is the removal of methyl groups in modified histone proteins via histone demethylases. These demethylases have been found to have potential oncogenic functions and involvement in other pathological processes. The discovery of histone demethylases demonstrates that histone methylation is not a permanent modification but rather a more dynamic process. Two major families of demethylases have been discovered: Lysine specific demethylase 1 (LSD1) and Jumonji domain containing (JmjC domain) histone demethylases (JMJD2, JMJD3/UTX and JARIDs). The specific amino acid residue and degree of methylation determines the demethylation enzyme. For example, on histone H3, mono- and di-methylated lysine 4 are demethylated by LSD1 (BHC110, KDM1) and tri-methylated lysine 4 by JARID (1A-1D); di- and tri-methylated lysine 27 are demethylated by JMJD3 and UTX (KDM6A) and mono- and di-methylated lysine 9 are demethylated by JMJD1 and tri-methylated lysine 9 is demethylated by JMJD2.2 Inhibition of histone demethylases may lead to histone re-methylation at specific residues important for chromatin dynamics and gene expression. Furthermore, detection of the activity and inhibition of these enzymes would be important in elucidating mechanisms of epigenetic regulation of gene activation and silencing and may benefit cancer diagnostics and therapeutics. A non-coding RNA (ncRNA) is a functional RNA molecule that is transcribed from DNA but not translated into proteins. Epigenetic related ncRNAs include miRNA, siRNA, piRNA and lncRNA. In general, ncRNAs function to regulate gene expression at the transcriptional and post-transcriptional level. Those ncRNAs that appear to be involved in epigenetic processes can be divided into two main groups; the short ncRNAs (<30 nts) and the long ncRNAs (>200 nts). The three major classes of short non-coding RNAs are microRNAs (miRNAs), short interfering RNAs (siRNAs), and piwi-interacting RNAs (piRNAs). Both major groups are shown to play a role in heterochromatin formation, histone modification, DNA methylation targeting, and gene silencing. MicroRNAs (miRNA) generally bind to a specific target messenger RNA with a complementary sequence to induce cleavage, or degradation or block translation. This may be done in the context of a feedback mechanism that involves chromosome methylation. For example, miRNA genes mir-127 and mir136 were found to be involved in regulating the genetic imprinting of Rtl1, a key gene involved in placenta formation in mice. Methylation of a specific region in the paternal chromosome results in expression of Rtl1. If the chromosome is not methylated, as on the maternal chromosome, mir-127 and mir136 are produced and bind to the Rtl1 transcript and induce degradation. Lack of Rtl1 protein expression due to improper epigenetic modifications can result in fetal death in mice.12 Short interfering RNAs (siRNA) function in a similar way as miRNAs to mediate post-transcriptional gene silencing (PTGS) as a result of mRNA degradation. In addition to this function, siRNAs have also been shown to induce heterochromatin formation via an RNA-induced transcriptional silencing (RITS) complex which when bound to siRNA promotes H3K9 methylation and chromatin condensation.3 Piwi-interacting RNAs (piRNA) are so named due to their interaction with the piwi family of proteins. The primary function of these RNA molecules involves chromatin regulation and suppression of transposon activity in germline and somatic cells. PiRNAs that are antisense to expressed transposons target and cleave the transposon in complexes with PIWI-proteins. This cleavage generates additional piRNAs which target and cleave additional transposons. This cycle continues to produce an abundance of piRNAs and augment transposon silencing.45 Long ncRNAs MlRNAlihhtidifiidihiltitiiifiiihhbdifi https://www.researchgate.net/publication/263097109_Altered_Histone_Modifications_in_Gliomas  transcriptional activation/inactivation,  chromosome packaging,  DNA damage/repair. genetic – Histone modifications role • Non coding RNAs are regulatory sequence that do not translate for any proteins • Function: negatively regulate gene expression by base pairing with a complementary mRNA sequence. • two categories based on size: 1. short chain non-coding RNAs (siRNAs, miRNAs, and piRNAs) 2. long non-coding RNA (lncRNAs) https://www.spandidos-publications.com/10.3892/or.2016.5236#:~:text=Abstract,involve%20altering%20the%20DNA%20sequence.&text=Non%2Dcoding%20RNAs%20are hllligenetic – Non-coding RNAs https://www.spandidos-publications.com/10.3892/or.2016.5236#:~:text=Abstract,involve%20altering%20the%20DNA%20sequence.&text=Non%2Dcoding%20RNAs%20are %20a,at%20the%20post%2Dtranscriptional%20level. igenetic – Non-coding RNAs genetic – X chromosome inactivation Both X chromosomes are expressed cause an impairment of the embryo development X chromosome inactivation One of the two X chromosomes is inactivated in female mammals (dosage compensation) X X X X X X X X X X X X X X Embryogenesis random inactivation Once an X-chromosome is inactivated will remain in that status throughout the lifetime of the cell genetic – X chromosome inactivation • X-chromosome inactivation is the transcriptional silencing of one X chromosome in female mammalian • random inactivation of X chromosome is regulated by Xist and Tsix genes that encode for antisense pair of non-coding RNAs https://www.sciencedirect.com/science/article/pii/S0022202X15337064 https://jbiol.biomedcentral.com/articles/10.1186/jbiol95#:~:text=X%2Dchromosome%20inactivation %20occurs%20randomly,coat%20the%20whole%20X%20chromosome. Tortoiseshell cat genetic – X chromosome inactivation mosaicism Identify an example of disease associate with a mutation of XchromosomeinactivationColor blindness, hemophilial • Genomic imprinting: when one copy of a gene is silenced due to its parental origin • The genes that undergo genomic imprinting is often marked or “stamped,” on the gene during the formation of egg and sperm cells. GAMETOGENESIS • Only a small percentage of all human genes undergo genomic imprinting. Play important role in the embryonic growth development igenetic – Genomic imprinting • Maternal imprinting: the allele of a particular gene inherited from the mother is transcriptionally silent and the paternallyinherited allele is active. • Paternal imprinting: the allele of a particular gene inherited from the father is transcriptionally silent and the maternallyinherited allele is active igenetic – Genomic imprinting https://www.geneimprint.com/site/genes-by-species Prader-Willi Syndrome -initial failure to thrive -distinctive facial features -developmental delay -hypogonadism Angelman Syndrome -seizures -jerky, uncoordinated movements -unprovoked smiling/laughter -lack of speech -severe developmental delay Paternal Maternal Deletions on chromosome 15 can result in PraderWilli or Angelman syndrome https://www.nature.com/scitable/topicpage/imprinting-and-genetic-disease-angelman-prader-willi-923 genetic – Genomic imprinting & disease https://www.frontiersin.org/articles/10.3389/fonc.2014.00071/full https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5075137/ https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5008069/ pigenetic – cancers Cancer epigenetics is the study of epigenetic modifications to the DNA of cancer cells that do not involve a change in the nucleotide sequence, but instead involve a change in the way the genetic code is expressed. Epigenetic mechanisms are necessary to maintain normal sequences of tissue specific gene expression and are crucial for normal development.[1] They may be just as important, if not even more important, than genetic mutations in a cell’s transformation to cancer. The disturbance of epigenetic processes in cancers, can lead to a loss of expression of genes that occurs about 10 times more frequently by transcription silencing (caused by epigenetic promoter hypermethylation of CpG islands) than by mutations. As Vogelstein et al. points out, in a colorectal cancer there are usually about 3 to 6 driver mutations and 33 to 66 hitchhiker or passenger mutations.[2] However, in colon tumors compared to adjacent normal-appearing colonic mucosa, there are about 600 to 800 heavily methylated CpG islands in the promoters of genes in the tumors while these CpG islands are not methylated in the adjacent mucosa.[3][4][5] Manipulation of epigenetic alterations holds great promise for cancer prevention, detection, and therapy.[6][7] In different types of cancer, a variety of epigenetic mechanisms can be perturbed, such as the silencing of tumor suppressor genes and activation of oncogenes by altered CpG island methylation patterns, histone modifications, and dysregulation of DNA binding proteins. There are several medications which have epigenetic impact, that are now used in a number of these diseases. In somatic cells, patterns of DNA methylation are in general transmitted to daughter cells with high fidelity.[8] Typically, this methylation only occurs at cytosines that are located 5′ to guanosine in the CpG dinucleotides of higher order eukaryotes.[9] However, epigenetic DNA methylation differs between normal cells and tumor cells in humans. The “normal” CpG methylation profile is often inverted in cells that become tumorigenic.[10] In normal cells, CpG islands preceding gene promoters are generally unmethylated, and tend to be transcriptionally active, while other individual CpG dinucleotides throughout the genome tend to be methylated. However, in cancer cells, CpG islands preceding tumor suppressor gene promoters are often hypermethylated, while CpG methylation of oncogene promoter regions and parasitic repeat sequences is often decreased.[11] Hypermethylation of tumor suppressor gene promoter regions can result in silencing of those genes. This type of epigenetic mutation allows cells to grow and reproduce uncontrollably, leading to tumorigenesis.[10] The addition of methyl groups to cytosines causes the DNA to coil tightly around the histone proteins, resulting in DNA that can not undergo transcription (transcriptionally silenced DNA). Genes commonly found to be transcriptionally silenced due to promoter hypermethylation include: Cyclindependent kinase inhibitor p16, a cell-cycle inhibitor; MGMT, a DNA repair gene; APC, a cell cycle regulator; MLH1, a DNA-repair gene; and BRCA1, another DNA-repair gene.[10][12] Indeed, cancer cells can become addicted to the transcriptional silencing, due to promoter hypermethylation, of some key tumor suppressor genes, a process known as epigenetic addiction.[13] Hypomethylation of CpG dinucleotides in other parts of the genome leads to chromosome instability due to mechanisms such as loss of imprinting and reactivation of transposable elements.[14][15][16][17] Loss of imprinting of insulin-like growth factor gene (IGF2) increases risk of colorectal cancer and is associated with BeckwithWiedemann syndrome which significantly increases the risk of cancer for newborns.[18] In healthy cells, CpG dinucleotides of lower densities are found within coding and non-coding intergenic regions. Expression of some repetitive sequences and meiotic recombination at centromeres are repressed through methylation [19] The entire genome of a cancerous cell contains significantly less methylcytosine than the genome of a healthy cell. In fact, cancer cell genomes have 20-50% less methylation at individual CpG dinucleotides across the genome.[14][15][16][17] CpG islands found in promoter regions are usually protected from DNA methylation. In cancer cells CpG islands are hypomethylated [20] The regions flanking CpG islands called CpG island shores are where most DNA methylation occurs in the CpG dinucleotide context. Cancer cells are deferentially methylated at CpG island shores. In cancer cells, hypermethylation in the CpG island shores move into CpG islands, or hypomethylation of CpG islands move into CpG island shores eliminating sharp epigenetic boundaries between these genetic elements.[21] In cancer cells “global hypomethylation” due to disruption in DNA methyltransferases (DNMTs) may promote mitotic recombination and chromosome rearrangement, ultimately resulting in aneuploidy when the chromosomes fail to separate properly during mitosis.[14][15][16][17] CpG island methylation is important in regulation of gene expression, yet cytosine methylation can lead directly to destabilizing genetic mutations and a precancerous cellular state. Methylated cytosines make hydrolysis of the amine group and spontaneous conversion to thymine more favorable. They can cause aberrant recruitment of chromatin proteins. Cytosine methylations change the amount of UV light absorption of the nucleotide base, creating pyrimidine dimers. When mutation results in loss of heterozygosity at tumor suppressor gene sites, these genes may become inactive. Single base pair mutations during replication can also have detrimental effects.[12] Histone modification Eukaryotic DNA has a complex structure. It is generally wrapped around special proteins called histones to form a structure called a nucleosome. A nucleosome consists of 2setsof4histones:H2A,H2B,H3,andH4.Additionally,histoneH1contributestoDNApackagingoutsideofthenucleosome.Certainhistonemodifyingenzymescanadd Other histone marks associated with tumorigenesis include increased deacetylation (decreased acetylation) of histones H3 and H4, decreased trimethylation of histone H3 Lysine 4 (H3K4me3), and increased monomethylation of histone H3 Lysine 9 (H3K9me) and trimethylation of histone H3 Lysine 27 (H3K27me3). These histone modifications can silence tumor suppressor genes despite the drop in methylation of the gene’s CpG island (an event that normally activates genes).[25][26] Some research has focused on blocking the action of BRD4 on acetylated histones, which has been shown to increase the expression of the Myc protein, implicated in several cancers. The development process of the drug to bind to BRD4 is noteworthy for the collaborative, open approach the team is taking. [27] The tumor suppressor gene p53 regulates DNA repair and can induce apoptosis in dysregulated cells. E Soto-Reyes and F Recillas-Targa elucidated the importance of the CTCF protein in regulating p53 expression.[28] CTCF, or CCCTC binding factor, is a zinc finger protein that insulates the p53 promoter from accumulating repressive histone marks. In certain types of cancer cells, the CTCF protein does not bind normally, and the p53 promoter accumulates repressive histone marks, causing p53 expression to decrease.[28] Mutations in the epigenetic machinery itself may occur as well, potentially responsible for the changing epigenetic profiles of cancerous cells. The histone variants of the H2A family are highly conserved in mammals, playing critical roles in regulating many nuclear processes by altering chromatin structure. One of the key H2A variants, H2A.X, marks DNA damage, facilitating the recruitment of DNA repair proteins to restore genomic integrity. Another variant, H2A.Z, plays an important role in both gene activation and repression. A high level of H2A.Z expression is detected in many cancers and is significantly associated with cellular proliferation and genomic instability.[11] Histone variant macroH2A1 is important in the pathogenesis of many types of cancers, for instance in hepatocellular carcinoma.[29] Other mechanisms include a decrease in H4K16ac may be caused by either a decrease in activity of a histone acetyltransferases (HATs) or an increase in deacetylation by SIRT1.[10] Likewise, an inactivating frameshift mutation in HDAC2, a histone deacetylase that acts on many histone-tail lysines, has been associated with cancers showing altered histone acetylation patterns.[30] These findings indicate a promising mechanism for altering epigenetic profiles through enzymatic inhibition or enhancement. A new emerging field that captures toxicological epigenetic changes as a result of the exposure to different compounds (drugs, food, and environment) is toxicoepigenetics. In this field, there is growing interest in mapping changes in histone modifications and their possible consequences.[31] DNA damage, caused by UV light, ionizing radiation, environmental toxins, and metabolic chemicals, can also lead to genomic instability and cancer. The DNA damage response to double strand DNA breaks (DSB) is mediated in part by histone modifications. At a DSB, MRE11-RAD50-NBS1 (MRN) protein complex recruits ataxia telangiectasia mutated (ATM) kinase which phosphorylates Serine 129 of Histone 2A. MDC1, mediator of DNA damage checkpoint 1, binds to the phosphopeptide, and phosphorylation of H2AX may spread by a positive feedback loop of MRN-ATM recruitment and phosphorylation. TIP60 acetylates the γH2AX, which is then polyubiquitylated. RAP80, a subunit of the DNA repair breast cancer type 1 susceptibility protein complex (BRCA1-A), binds ubiquitin attached to histones. BRCA1-A activity arrests the cell cycle at the G2/M checkpoint, allowing time for DNA repair, or apoptosis may be initiated.[32] MicroRNA gene silencing In mammals, microRNAs (miRNAs) regulate about 60% of the transcriptional activity of protein-encoding genes.[33] Some miRNAs also undergo methylationassociated silencing in cancer cells.[34][35] Let-7 and miR15/16 play important roles in down-regulating RAS and BCL2 oncogenes, and their silencing occurs in cancer cells.[18] Decreased expression of miR-125b1, a miRNA that functions as a tumor suppressor, was observed in prostate, ovarian, breast and glial cell cancers. In vitro experiments have shown that miR-125b1 targets two genes, HER2/neu and ESR1, that are linked to breast cancer. DNA methylation, specifically hypermethylation, is one of the main ways that the miR-125b1 is epigenetically silenced. In patients with breast cancer, hypermethylation of CpG islandslocatedproximaltothetranscriptionstartsitewasobservedLossofCTCFbindingandanincreaseinrepressivehistonemarksH3K9me3and Dysregulation of metabolism allows tumor cells to generate needed building blocks as well as to modulate epigenetic marks to support cancer initiation and progression. Cancer-induced metabolic changes alter the epigenetic landscape, especially modifications on histones and DNA, thereby promoting malignant transformation, adaptation to inadequate nutrition, and metastasis. In order to satisfy the biosynthetic demands of cancer cells, metabolic pathways are altered by manipulating oncogenes and tumor suppressive genes concurrently.[38] The accumulation of certain metabolites in cancer can target epigenetic enzymes to globally alter the epigenetic landscape. Cancerrelated metabolic changes lead to locus-specific recoding of epigenetic marks. Cancer epigenetics can be precisely reprogramed by cellular metabolism through 1) doseresponsive modulation of cancer epigenetics by metabolites; 2) sequence-specific recruitment of metabolic enzymes; and 3) targeting of epigenetic enzymes by nutritional signals.[38] In addition to modulating metabolic programming on a molecular level, there are microenvironmental factors that can influence and effect metabolic recoding. These influences include nutritional, inflammatory, and the immune response of malignant tissues. DNA damage appears to be the primary underlying cause of cancer.[39] [40] If DNA repair is deficient, DNA damage tends to accumulate. Such excess DNA damage can increase mutational errors during DNA replication due to error-prone translesion synthesis. Excess DNA damage can also increase epigenetic alterations due to errors during DNA repair.[41][42] Such mutations and epigenetic alterations can give rise to cancer (see malignant neoplasms). Germ line mutations in DNA repair genes cause only 2–5% of colon cancer cases.[43] However, altered expression of microRNAs, causing DNA repair deficiencies, are frequently associated with cancers and may be an important causal factor for these cancers. Over-expression of certain miRNAs may directly reduce expression of specific DNA repair proteins. Wan et al.[44] referred to 6 DNA repair genes that are directly targeted by the miRNAs indicated in parentheses: ATM (miR-421), RAD52 (miR-210, miR-373), RAD23B (miR-373), MSH2 (miR-21), BRCA1 (miR-182) and P53 (miR-504, miR-125b). More recently, Tessitore et al.[45] listed further DNA repair genes that are directly targeted by additional miRNAs, including ATM (miR-18a, miR-101), DNA-PK (miR-101), ATR (miR185), Wip1 (miR-16), MLH1, MSH2 and MSH6 (miR-155), ERCC3 and ERCC4 (miR-192) and UNG2 (mir-16, miR-34c and miR-199a). Of these miRNAs, miR-16, miR-18a, miR-21, miR-34c, miR-125b, miR-101, miR-155, miR-182, miR-185 and miR-192 are among those identified by Schnekenburger and Diederich[46] as over-expressed in colon cancer through epigenetic hypomethylation. Over expression of any one of these miRNAs can cause reduced expression of its target DNA repair gene. Up to 15% of the MLH1-deficiencies in sporadic colon cancers appeared to be due to over-expression of the microRNA miR-155, which represses MLH1 expression.[47] However, the majority of 68 sporadic colon cancers with reduced expression of the DNA mismatch repair protein MLH1 were found to be deficient due to epigenetic methylation of the CpG island of the MLH1 gene.[48] In 28% of glioblastomas, the MGMT DNA repair protein is deficient but the MGMT promoter is not methylated.[49] In the glioblastomas without methylated MGMT promoters, the level of microRNA miR-181d is inversely correlated with protein expression of MGMT and the direct target of miR-181d is the MGMT mRNA 3’UTR (the three prime untranslated region of MGMT mRNA).[49] Thus, in 28% of glioblastomas, increased expression of miR-181d and reduced expression of DNA repair enzyme MGMT may be a causal factor. In 29–66%[49][50] of glioblastomas, DNA repair is deficient due to epigenetic methylation of the MGMT gene, which reduces protein expression of MGMT. High mobility group A (HMGA) proteins, characterized by an AT-hook, are small, nonhistone, chromatin-associated proteins that can modulate transcription. MicroRNAs control the expression of HMGA proteins, and these proteins (HMGA1 and HMGA2) are architectural chromatin transcription-controlling elements. Palmieri et al.[51] showed that, in normal tissues, HGMA1 and HMGA2 genes are targeted (and thus strongly reduced in expression) by miR-15, miR-16, miR-26a, miR-196a2 and Let-7a. HMGA expression is almost undetectable in differentiated adult tissues but is elevated in many cancers. HGMA proteins are polypeptides of ~100 amino acid residues characterized by a modular sequence organization. These proteins have three highly positively charged regions, termed AT hooks, that bind the minor groove of AT-rich DNA stretches in specific regions of DNA. Human neoplasias, including thyroid, prostatic, cervical, colorectal, pancreatic and ovarian carcinoma, show a strong increase of HMGA1a and HMGA1b proteins.[52] Transgenic mice with HMGA1 targeted to lymphoid cells develop aggressive lymphoma, showing that high HMGA1 expression is not only associated with cancers, but that the HMGA1 gene can act as an oncogene to cause cancer.[53] Baldassarre et al.,[54] showed that HMGA1 protein binds to the promoter region of DNA repair gene BRCA1 and inhibits BRCA1 promoter activity. They also showed that while only 11% of breast tumors had hypermethylation of the BRCA1 gene, 82% of aggressive breast cancers have low BRCA1 protein expression, and most of these reductions were due to chromatin remodeling by high levels of HMGA1 protein. tics in Cancer. Manel Esteller. N Engl J Med 2008;358:1148-59. pigenetic – case studies https://citeseerx.ist.psu.edu/viewdoc/download?doi=10.1.1.1090.5634&rep=rep1&type=pdf https://www.frontiersin.org/articles/10.3389/fpsyt.2019.00808/full%20 https://www.sciencedirect.com/science/article/pii/B9780128053881000316 Sickle-cell anemia is one of hundreds of life-threatening disorders that are known to be caused by a change in just one of those 3 billion A’s, T’s, C’s, or G’s. Because so many diseases are associated with mutations, it is common for mutations to have a negative connotation. However, while many mutations are indeed deleterious, others are “silent”; that is, they have no discernible effect on the phenotype of an individual and remain undetected unless a molecular biologist takes a DNA sample for sequence analysis. In addition, some mutations are actually beneficial. For example, the very same mutation that causes sickle-cell anemia in affected individuals (i.e., those people who have inherited two mutant copies of the beta globin gene) can confer a survival advantage to unaffected carriers (i.e., those people who have inherited one mutant copy and one normal copy of the gene, and who generally do not show symptoms of the disease) when these people are challenged with the malaria pathogen. As a result, the sickle-cell mutation persists in populations where malaria is endemic. Beyond the individual level, perhaps the most dramatic effect of mutation relates to its role in evolution; indeed, without mutation, evolution would not be possible. This is because mutations provide the “raw material” upon which the mechanisms of natural selection can act. By way of this process, those mutations that furnish individual organisms with characteristics better adapted to changing environmental conditions are passed on to offspring at an increased rate, thereby influencing the future of the species. The Relationship Between Mutations and Polymorphisms While a mutation is defined as any alteration in the DNA sequence, biologists use the term “single nucleotide polymorphism” (SNP) to refer to a single base pair alteration that is common in the population. Specifically, a polymorphism is any genetic location at which at least two different sequences are found, with each sequence present in at least 1% of the population. Note that the term “polymorphism” is generally used to refer to a normal variation, or one that does not directly cause disease. Moreover, the cutoff of at least 1% prevalence for a variation to be classified as a polymorphism is somewhat arbitrary; if the frequency is lower than this, the allele is typically regarded as a mutation (Twyman, 2003). SNPs are important as markers, or signposts, for scientists to use when they look at populations of organisms in an attempt to find genetic changes that predispose individuals to certain traits, including disease. On average, SNPs are found every 1,000–2,000 nucleotides in the human genome, and scientists participating in the International HapMap Consortium have mapped millions of these alterations (International Human Genome Sequencing Consortium, 2001). The DNA in any cell can be altered through environmental exposure to certain chemicals, ultraviolet radiation, other genetic insults, or even errors that occur during the process of replication. If a mutation occurs in a germ-line cell (one that will give rise to gametes, i.e., egg or sperm cells), then this mutation can be passed to an organism’s offspring. This means that every cell in the developing embryo will carry the mutation. As opposed to germ-line mutations, somatic mutations occur in cells found elsewhere in an organism’s body. Such mutations are passed to daughter cells during the process of mitosis (Figure 2), but they are not passed to offspring conceived via sexual reproduction. How Mutations Occur As previously mentioned, DNA in any cell can be altered by way of a number of factors, including environmental influences, certain chemicals, spontaneous mutations, and errors that occur during the process of replication. Each of these mechanisms is discussed in greater detail in the following sections. DNA interacts with the environment, and sometimes that interaction can be detrimental to genetic information. In fact, every time you go outside, you put your DNA in danger, because ultraviolet (UV) light from the Sun can induce mutations in your skin cells. One type of UV-generated mutation involves the hydrolysis of a cytosine base to a hydrate form, causing the base to mispair with adenine during the next round of replication and ultimately be replaced by thymine. Indeed, researchers have found an extremely high rate of occurrence of this UV-induced C-to-T fingerprint-type mutation in genes associated with basal cell carcinoma, a form of skin cancer (Seidl et al., 2001). UV light can also cause covalent bonds to form between adjacent pyrimidine bases on a DNA strand, which results in the formation of pyrimidine dimers. Repair machinery exists to cope with these mutations, but it is somewhat prone to error, which means that some dimers go unrepaired. Furthermore, some people have an inherited genetic disorder called xeroderma pigmentosum (XP), which involves mutations in the genes that code for the proteins involved in repairing UV-light damage. In people with XP, exposure to UV light triggers a high frequency of mutations in skin cells, which in turn results in a high occurrence of skin cancer. As a result, such individuals are unable to go outdoors during daylight hours. In addition to ultraviolet light, organisms are exposed to more energetic ionizing radiation in the form of cosmic rays, gamma rays, and X-rays. Ionizing radiation induces double-stranded breaks in DNA, and the resulting repair can likewise introduce mutations if carried out imperfectly. Unlike UV light, however, these forms of radiation penetrate tissue well, so they can cause mutations anywhere in the body. Mutations Caused by Chemicals Oxidizing agents, commonly known as free radicals, are substances that can chemically modify nucleotides in ways that alter their base-pairing capacities. For instance, dioxin intercalates between base pairs, disrupting the integrity of the DNA helix and predisposing that site to insertions or deletions. Similarly, benzo[a]pyrene, a known carcinogen and a component of cigarette smoke, has been demonstrated to induce lesions at guanine bases in the tumor suppressor gene P53 at codons 157, 248, and 273. These codons are the major mutational hot spots seen in clinical studies of human lung cancers (Denissenko et al., 1996). Mutations such as these that are fairly specific to particular mutagens are called signature mutations. A variety of chemicals beyond those mentioned here are known to induce such mutations. Spontaneous Mutations Mutations can also occur spontaneously. For instance, depurination (Figure 5), in which a purine base is lost from a nucleotide through hydrolysis even though the sugar-phosphate backbone is unaltered, can occur without an explicit insult from the environment. If uncorrected by DNA repair enzymes, depurination may result in the incorporation of an incorrect base during the next round of replication. Karyotype analysis: Introduction • Karyotyping: the process of pairing and ordering all the chromosome of an individual -> pictorial /photographic representation <- size order • Example: 46, XX; 46, XY; 104, Carp; 8, Fruit fly Tang, Q., Chen, Q., Lai, X. & Lui, S., 2013. Malignant Transformation Potentials of Human Umbilical Cord Mesenchymal Stem Cells Both Spontaneously and via 3-Methycholanthrene Induction. PLoS ONE, 8(12), p. e81844. Karyotype analysis: Procedure • Sample: general diagnosis -> peripheral blood specimens or skin biopsy cancer diagnosis -> tumour biopsy or bone marrow prenatal diagnosis -> amniotic fluid or chorionic villus 0.5 ml blood in 5 ml culture medium Add phytohaemagglutinin Culture 48-72 hours Add colcemid Add hypotonic KCL and fix in 3:1 Methanol: Acetic acid Drop on to microscope slide Digest with trypsin and stain with Giemsa Cells arrested in the metaphase Karyotype analysis: Nomenclature • Key points • p (petite) -> short arm • q (queue) -> long arm • Metacentric chromosome -> length of p = q • Submetacentric chromosome -> length of p < q • Acrocentric chromosome -> length of p << q Karyotype analysis: Nomenclature • Key points • p (petite) -> short arm • q (queue) -> long arm • Metacentric chromosome -> length of p = q • Submetacentric chromosome -> length of p < q • Acrocentric chromosome -> length of p << q • Chromosomal region decoding: 5p31.2 • 5 = • p = • 3 = • 1 = • 2 = “5p31.2 = five p three one point two” Karyotype analysis: Application • Abnormalities detection -> diagnosis confirmation • Numerical: change in number of chromosomes • Polyploidy: possession of an extra SET of chromosomes -> rare in human • Aneuploidy: absence or addition of a chromosome -> n = 45 or n = 47 example -> an extra copy of chromosome = trisomy -> missing a copy of chromosome = monosomy • Structural: change in structure of chromosomes <- loss or duplication of fragments / chromosomal arm Balanced Translocation (t) A portion of chromosome exchanges place with a portion from another chromosome Inversion (inv) A segment of chromosome breaks off, turns upside-down and reattaches itself Insertion (ins) A segment of chromosome is inserted to another chromosome Unbalanced Deletion (del) A portion of chromosome is lost Duplication (dup) A portion of chromosome is duplicated Karyotype analysis: Application • Abnormalities detection -> diagnosis confirmation • Numerical: change in number of chromosomes • Structural: change in structure of chromosomes <- loss or duplication of fragments / chromosomal arm ______________ ____________ _______________ ________________ ________________ Chromosome abnormalities – Numerical • Polyploidy: Triploidy (69, XXX or 69, XXY) • A condition with three complete sets of chromosomes in a single cell • Prevalence: 1 in 50,000 live birth infants • Nearly all triploid pregnancies are spontaneously aborted during the first trimester • Causes: 1 egg + 2 sperms, 1 egg + 1 sperm (2n), 1 egg (2n) +1 sperm, 1 fertilised egg + 1 sperm Wick, J. B., Johnson, K. J., O’Brien, J., & Wick, M. J. (2012). Second-trimester diagnosis of triploidy: a series of four cases. AJP reports, 3(1), 37-40. Chromosome abnormalities – Numerical • Polyploidy: Tetraploidy (92, XXXX or 92, XXYY) • A condition with four complete sets of chromosomes in a single cell • Prevalence: rare • Majority of tetraploid pregnancies are spontaneously aborted • Causes: chromosome duplication in a somatic cell in an early stage embryo, 2n egg + 2n sperm • Intrauterine hypotrophy • Postnatal growth retardation • High and prominent forehead • Low-set and dysplastic ears • Feet and hand abnormality • Beaked nose and micrognathia Bothur-Nowacka J, Jezela-Stanek A., Zaniuk K., Goryluk-Kozakiewicz B., KrajewskaWalasek M. and Dobrzańska A (2013), Tetraploidy in the era of molecular karyotyping – What we need to remember, Pediatria Polska 88(5), 467-471 Chromosome abnormalities – Numerical • Aneuploidy: monosomy X (45, X – Turner syndrome) • Partial or complete loss of an X chromosome in females • Prevalence: 1 in 2,500 newborn girls • Nearly all pregnancy are spontaneously aborted • Life expectancy: 30 – 40 years <- cardiac problem Chromosome abnormalities – Numerical • Aneuploidy: monosomy (45, X – Turner syndrome) • Clinical features • Sexual immaturity • Learning difficulty – normal intelligence • A short stature – under 5 feet in height • A web between the neck and shoulders • Low posterior hairline • Lymphatic abnormalities https://www.omicsonline.org/united-states/turner-syndrome-peer-reviewed-pdf-pptarticles/ Chromosome abnormalities – Numerical • Aneuploidy: trisomy (47, XXY – Klinefelter syndrome) • One Y chromosome and multiple X chromosomes • Prevalence: 1 in 500 to 1,000 newborn boys • Life expectancy: normal Chromosome abnormalities – Numerical • Aneuploidy: trisomy (47, XXY – Klinefelter syndrome) • Clinical features • A tall stature • Long limbs with large hands and feet • Have male genitalia with small testes • Infertile • Gynecomastia with slight widen hips • Learning difficulties • Curvature of spine and osteoporosis Learning objectives • At the end of the session you should be able to • Describe the karyotype and clinical features of chromosomal abnormalities • Numerical: aneuploidy – autosomal chromosome • Trisomy 13 – Patau’s syndrome • Trisomy 18 – Edwards’ syndrome • Trisomy 21 – Sporadic Down’s syndrome • Structural: • Balanced – Familial Down’s syndrome • Unbalanced – Cri-du-chat syndrome and Charcot-Marie-Tooth Type 1A syndrome Karyotype analysis: Recap • Karyotyping: the process of pairing and ordering all the chromosome of an individual -> pictorial /photographic representation <- size order • Example: 46, XX; 46, XY; 104, Carp; 8, Fruit fly Tang, Q., Chen, Q., Lai, X. & Lui, S., 2013. Malignant Transformation Potentials of Human Umbilical Cord Mesenchymal Stem Cells Both Spontaneously and via 3-Methycholanthrene Induction. PLoS ONE, 8(12), p. e81844. Karyotype analysis: Recap • Abnormalities detection -> diagnosis confirmation • Numerical: change in number of chromosomes • Polyploidy: possession of an extra SET of chromosomes -> rare in human • Aneuploidy: absence or addition of a chromosome -> n = 45 or n = 47 example -> an extra copy of chromosome = trisomy -> missing a copy of chromosome = monosomy • Structural: change in structure of chromosomes <- loss or duplication of fragments / chromosomal arm Balanced A portion of chromosome exchanges place with a portion from another chromosome A segment of chromosome breaks off, turns upside-down and reattaches itself A segment of chromosome is inserted to another chromosome Unbalanced A portion of chromosome is lost A portion of chromosome is duplicated Chromosome abnormalities – Numerical • Aneuploidy: trisomy 13 – Patau’s syndrome • Extra copy of chromosome 13 • Clinical features • Holoprosencephaly/microcephaly • Learning disabilities • Microphthalmia • Cleft lip/palate • Rocket bottom feet • Polydactyly • Renal dysplasia Chromosome abnormalities – Numerical • Aneuploidy: trisomy 18 – Edwards’ syndrome • Extra copy of chromosome 18 Chromosome abnormalities – Numerical • Aneuploidy: trisomy 18 – Edwards’ syndrome • Clinical features • Overlapping of the index finger – clenched • Prominent occiput • Severe learning difficulties • Low birth weight • Heart defect Chromosome abnormalities – Numerical • Aneuploidy: trisomy 21 – Sporadic Down’s syndrome • Extra copy of chromosome 21 Chromosome abnormalities – Numerical • Aneuploidy: trisomy 21 – Down’s syndrome • Clinical features • Flattened nose and face • A single transverse palmer crease • Open mouth with protruding tongue • Space between first and second toes • Congenital heart disease • Hypothyroidism • Learning difficulties Chromosome abnormalities – Structural • Familial Down’s syndrome • Balanced structural abnormality • Translocation of genetic material between chromosome 14 and chromosome 21 -> 3 copies of chromosome 21 • Clinical feature is the same as sporadic Chromosome abnormalities – Structural • Cri-du-chat (Cat’s cry) syndrome • Unbalanced structural abnormality • Chromosome 5p deletion – vary in size • Clinical features • High pitched cry (cat’s like) • Microcephaly • Round face • Broad nasal bridge • Low-set ears • Severe learning disabilities Chromosome abnormalities – Structural • Charcot-Marie-Tooth Type 1A syndrome • Unbalanced structural abnormality • Duplication of PMP22 gene on 17p https://www.msdmanuals.com/en-gb/home/brain,-spinal-cord,-and-nervedisorders/peripheral-nerve-and-related-disorders/charcot-marie-toothdisease Genetic inheritance: Autosomal dominant and recessive X-linked recessive Chromosome abnormalities – Structural • Charcot-Marie-Tooth Type 1A syndrome • Unbalanced structural abnormality • Duplication of PMP22 gene on 17p • Clinical features • Severe neuropathy – hands and lower legs • Progressive muscle weakness • Bilateral foot drop https://www.bbc.co.uk/news/av/uk -england-leicestershire-58501877 https://www.bbc.co.uk/news/uk-wales-63303838 Monogenetic Disorder • Monogenic disorders (monogenic traits) are caused by variations in a SINGLE gene • Often manifest during childhood and lead to morbidity and sometimes premature death • Rare diseases that affect about 6% of people • It is typically inherited in a classical Mendelian fashion • The three most common patterns of inheritance are: 1. Autosomal dominant 2. Autosomal recessive 3. X-linked recessive Term Meaning Gene A segment of DNA which specifies a functional polypeptide and it is passed from parents to offspring Allele A variant form of a particular gene Genotype The genetic makeup of an organism (AA, Aa and aa) Homozyg ous Having two identical alleles for a particular gene (AA, aa) Heterozy gous Having two different alleles for a particular gene (Aa) Phenotyp e The physical characteristics of an organism (such as: tall) Punnet Square Diagram that can be used to predict the genotype and phenotypes resulting from a genetic cross Pedigree A genetic representation of a family tree that shows the presence or absence of a phenotype within a family acrossgenerations.Terminology Allele Pedigre Punnett Square A Punnett square can be used to predict genotype and phenotypes of offspring of a single trail (allele) b b B B b Father genotype Bb b B: dominant brown eyes allele B b b b bb Mother genotype bb Punnett Square Pedigree charts – Family tree Autosomal Recessive Inheritance Mutated gene is on one of the autosomes chromosomes (1-22) TWO mutated alleles (one inherited from each parent) need to be present for the phenotype/disease Process by which genetic information is passed on from parent to child (AR)  Homozygous AA = unaffected person – asymptomatic without mutation  Homozygous aa = Affected person – symptomatic with homozygotic mutation  Heterozygous Aa = Carrier person – asymptomatic with heterozygotic mutation (A = dominant allele; a = recessive allele/ mutated allele) AR – Genotype & Phenotype calculate the probability of the possible genotype and phenotype of the offspring of the following couple: Mother: asymptomatic with a heterozygotic mutation Father: asymptomatic without mutation A a A A Father Mother A Punnett square can be used to predict genotype and phenotypes of offspring from a genetic crosses AR – Punnett Square Horizontal pedigree AR – Family tree/ Pedigree Consanguinity increases the probability to acquire a autosomal recessive conditions amongst children from parents which are related each other Increase the probability to acquire both faulty genes AR – Consanguinity AR – Disease System Disorder Metabolic Cystic Fibrosis Phenylketonuria Galactosemia Homocystinuria Lysosomal storage disease Wilson disease Hemochromatosis Glycogen storage disease Hematopoietic Sickle cell anemia Thalassemia Endocrine Congenital adrenal hyperplasia Skeletal Alkaptonuria Nervous Neurogenic muscular atrophies Friedreich ataxia Spinalmuscularatrophy • It is a life-threatening disorder that causes severe damage to lungs, digestive system and reproductive systems • 1:2500 incidence in North of Europe • 75% of people with CF are diagnosed by age 2 • Mutations in Cystic fibrosis transmembrane conductance regulator gene (CFTR) (7q31) AR – Cystic Fibrosis (CF) Lungs: Thick mucus builds up and gets stuck in the airways: – Persistent coughing – Trouble breathing – Continuous infection Digestive system: Thick mucus blocks pancreatic ducts. Digestive enzymes can’t get through to the stomach: malabsorption of nutrients – Poor growth or poor weight gain despite a good appetite https://pedsinreview.aappublications.org/content/ //Reproductive system : Men: thick mucus can block sperm release Women: thick mucus can reduce sperm from entering their reproductive system CF – Symptoms: Very salty-tasting skin Medical genetics –e-book; Lynn B. Jorde, John C. Carey, and Michael J. Bamshad Pancre as Lungs Picture from: https://www.frontiersin.org/articles/10.3389/fphar.2019.01662/fulCF – Genetic causes • CFTR gene codes for a cystic fibrosis transmembrane conductance regulator (CFTR) protein • Cytogenetic Location: 7q31.2 • CFTR protein is a member of the ATP-binding cassette (ABC) transporter superfamily. • CFTR channel is found on the surface membrane of epithelia cells Picture from: https://www.frontiersin.org/articles/10.3389/fphar.2019.01662/full CF – Genetic causes CFTR protein has 5 domains: 2x transmembrane domains (TMD1 and TMD2) 2x nucleotide-binding domains (NBD1 and NBD2) 1x Regulatory domain (RD) form the channel pore ATP binding and hydrolysis Regulate opening and closing gate helps to control the movement of water in tissues necessary to produce thin, freely flowingmucus• CFTR protein functions as a channel across the membrane of cells that produce: • CFTR regulated the transport of chloride ions (Cl− ) across epithelial cell membranes • mucus • sweat • saliva • tears • digestive enzymes CF – Genetic causes https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3372304 CF – Genetic causes • More than 2000 mutations in the CFTR gene have been identified in people with CF • CFTR mutations may impair mRNA and protein expression, function, stability or a combination of these • Mutations in the CFTR gene disrupt the flow of Cl− ions and H2O across cell membranes → accumulation of thick and sticky mucus • F508del is the most prevalent CF-causing mutationaffectingapproximately82%of Identify how many different classes of CFTR mutations there are and summarise the effect of each mutation classes on the CFTR protein function. Best practice guidelines for molecular genetic diagnosis of cystic fi brosis and CFTR-related disorders – updated European recommen dations – PMC (nih.gov) CF – extra reading CF – Diagnosis • Sweat test: it measures the amount of salt chemicals (sodium and chloride) in the sweat.(>60 mmol/L – reference value <30 mmol/L) • Newborn screening test: measurement of the level of ImmunoReactive Trypsinogen (IRT) (chemical released by the pancreas) • Carrier testing: A simple mouthwash or blood test can determine if you are a carrier of the defective gene that causes cystic fibrosis CF – Diagnosis in adults most cases of CF are now diagnosed shortly after birth but sometimes the condition may not be diagnosed until later in life → partial functionality of CFTR • Family history • sweat test • blood test, • sputum (mucus) test, • lung function test to measure breathing • X-ray, CT scan, and/or MRI – lung physiology CF – Treatments Medication Actions Antibiotics Treat and prevent lung infections Anti-inflammatory Reduce swelling in the airways in lungs Mucus-thinning drugs (hypertonic saline) cough up the mucus Inhaled medications (bronchodilators) keep airways open by relaxing the muscles around bronchial tubes Oral pancreatic enzymes help digestive tract absorb nutrients Target therapy – CFTR modulator therapies correct the malfunctioning CFTR protein – specific mutation CFTR modulator therapies • CFTR modulators are a class of drugs that act by improving: • production • intracellular processing • and/or function • CFTR modulators have been approved by the U.S. Food and Drug Administration (FDA) for people with the specific CF mutations • There are four CFTR modulators for people with certain CFTR mutations: • Kalydeco® (ivacaftor) • Orkambi® (lumacaftor/ivacaftor) • Symdeko® (tezacaftor/ivacaftor) • Trikafta® (elexacaftor/tezacaftor/ivacaftor) most used https://www.frontiersin.org/articles/10.3389/fphar.2019.01662/full defective CFTR protein  Potentiators: Therapeutic agents that improve the channel-open probability and potentiate mutated CFTR gating  Correctors: are small molecules that improve the trafficking of mutated CFTR (Class II mutations, e.g., F508del) from ER to the apical PM and increase CFTR cell surface expression.  Read-through agents: reduce the ribosomal ability to proofread and enable ribosomes to skip the stop codon, leading to the formation of functional protein.  Amplifiers: are compounds that enhance the expression of CFTR protein, with a following increase of its quantity in the ER and the PM. https://www.nhs.uk/news/genetics-and-stem-cells/gene-therapy-breakthrough-for-cystic-fibrosis/ https://www.frontiersin.org/articles/10.3389/fphar.2018.01381/full Others CFTR therapies Personalised medicine National Heart, Lung, and Blood Institute (USA): “Personalised medicine is the use of diagnostic and screening methods to better manage the individual patient’s disease or predisposition toward a disease…” Personalised medicine • Traditional medicine: ‘One size fits’ all approach • Personalised medicine: Customised treatment for individual patients • Personalised medicine uses patient genotype and phenotype to tailor treatment strategy to the patient Technology • Personalised medicine has been made possible by: • Increasing technology • Decreasing sequencing costs The Human Genome Project and personalised medicine The Human Genome Project and subsequent projects (eg 100 000 Genomes, the new GenOMICC COVID-19 Study) are enabling information from our genome to be used in medicine https://www.nature.com/news/personalized-medicine-time-for-one-person-trials-1.17411 Illustration by Greg Clarke https://covid.genomicc.org/ Four ‘P’s of Personalised Medicine (NHS England) • Prevention and prediction: Identifying genetic disease and those at increased risk • Precise diagnosis: Symptom based diagnosis is less accurate than genetics • Personalised targeted interventions: Move away from trial and error prescribing where drugs are currently effective in only 30-60% of patients due to differing individual responses to drugs • Participation of patients: Increase in data allows personalised consultations and lifestyle changes https://pixabay.com/ Personalised medicine will provide opportunities to improve how we treat disease (NHS England) All patients with the same condition are given the same treatment. Assumes all patients respond to a drug in the same way https://www.england.nhs.uk/wpcontent/uploads/2016/09/improvingoutcomes-personalised-medicine.pdf Traditionally: https://www.england.nhs.uk/wpcontent/uploads/2016/09/improvingoutcomes-personalised-medicine.pdf Lung cancer – NHS molecular diagnosis and treatment stratification 3 Treatment stratified (divided into different groups) 1 Patients diagnosed with lung cancer 2 Mutation analysis 1 2 2 2 2 3 3 3 3 Personalising lung cancer treatment • Tailoring treatment to the underlying cause of the cancer • NHS testing for: – Epidermal growth factor receptor tyrosine kinase (EGFR-TK) mutation – Anaplastic lymphoma kinase (ALK) mutation • One of the most common and most serious types of cancer • Early diagnosis can make a big difference but lung cancer does not usually cause noticeable symptoms until it has spread through the lungs or into other parts of the body • Approximately 1 in 3 people live for at least a year after diagnosis • 85% of cases caused by smoking Lung cancer https://www.nhs.uk/conditions/lung-cancer/ https://www.theverge.com/ 2016/4/4/11345936/france-plain-cigarettepack-law https://www.nhs.uk/better-health/quit-smokin g/?WT.mc_ID=JanQuitSmokingPPC& Lung cancer • Traditional medicine: ‘One size fits’ all approach • Patient diagnosed with lung cancer receives traditional treatment Surgery removes cancer cells Chemotherapy drugs kill cancer cells Radiotherapy: targeted radiation kills cancer cells Lung cancer https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4367711/ Histology Histology Sequencing IHC/FISH Non small cell lung cancer Small cell lung cancer Non small cell lung cancer Lung cancer • Symptoms: Persistent cough, coughing up blood, breathlessness, weight loss • GP Specialist Tests: X-ray, scans, biopsy, testing for gene mutations • NSCLC treatments: Surgery (main treatment if the cancer is small and has not spread), chemotherapy, radiotherapy, targeted drugs https://www.cancerresearchuk.org/about-cancer/lung-cancer/treatment/non-small-cell-lung-cancer https://www.nice.org.uk/guidance/dg9/chapter/3-clinical-need-and-practice https://www.nhs.uk/conditions/lung-cancer/treatment/ Non small cell lung cancer (NSCLC) adenocarcinoma: Positive test for epidermal growth factor receptor tyrosine kinase (EGFR-TK) mutation • Treatment with EGFR-TK inhibitor Positive test for anaplastic lymphoma kinase (ALK) fusion genes • Treatment with ALK inhibitor NHS molecular diagnosis of lung cancer type Epidermal growth factor receptor tyrosine kinase (EGFR-TK) mutation testing • The test detects who might benefit from treatment with EGFR–TK inhibitors (anticancer drugs that target specific tumour cells in patients with mutated forms of the EGFR–TK gene) rather than chemotherapy • DNA sequencing technique is used along with more sensitive probe based assay for small amounts of DNA https://meetinglibrary.asco.org/record/89180/edbook#bibr20-EdBookAM201434e353 https://www.nice.org.uk/guidance/dg9/chapter/4-The-diagnostic-tests Normal (unmutated) epidermal growth factor receptor tyrosine kinase (EGFR-TK) Cell EGFR-TKs are located in the cell membrane Cell proliferation and survival Cell proliferation and survival Growth factor ligand Epidermal growth factor receptor tyrosine kinase activity Tyrosine kinases transfer P from ATP onto other proteins to activate them Tyr Tyr Tyr Tyr Tyr Tyr P P P P P P https://meetinglibrary.asco.org/record/89180/edbook#bibr20-EdBookAM201434e353 Epidermal growth factor receptor tyrosine kinase mutants Cell proliferation and survival No ligand binding Cell proliferation and survival Mutant EGFR-TKs are overexpressed (expressed in larger numbers than normal). Mutants are not downregulated by endocytosis https://meetinglibrary.asco.org/record/89180/edbook#bibr20-EdBookAM201434e353 Mutant EGFR-TKs are constitutively active (do not require ligand binding for activation) EGFR-TKIs are small molecules that can diffuse through membranes Cell proliferation and survival EGFR-TKIs compete reversibly with ATP for the ATP binding site Epidermal growth factor receptor tyrosine kinase inhibitors (EGFR-TKIs) Epidermal growth factor receptor tyrosine kinase (EGFR-TK) mutations Mutation hotspot: In NSCLC EGFR-TK mutations are clustered in the kinase domain. At the start of treatment, most patients do not have mutations resistant to EGFR-TKIs https://meetinglibrary.asco.org/record/89180/edbook#bibr20-EdBookAM201434e353 Drug resistance – a huge problem for patients taking EGFR-TK and ALK inhibitors https://www.the-scientist.com/features/how-cancers-evolve-drug-resistance-31742 © NIRJA DESAI Acquired resistance to targeted drug therapy Epidermal growth factor receptor tyrosine kinase (EGFR-TK) drug resistance Acquired resistance is the main limitation of long term use of EGFR-TKIs: 50% of patients develop second site mutations, usually T790M https://meetinglibrary.asco.org/record/89180/edbook#bibr20-EdBookAM201434e353 New EGFR-TKI • Osimertinib • Developed to target T790M mutant EGFR-TKs https://www.videotranslation.net/staying-ahead-of-competition-in-the-market/ Lung cancer https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4367711/ Histology Histology Sequencing FISH Non small cell lung cancer Small cell lung cancer Non small cell lung cancer ALK (anaplastic lymphoma kinase) • ALK was first identified in lymphoma • Tyrosine kinase • Forms fusion protein with EML4 • EML4 and ALK biology is poorly understood • ALK endogenous ligand not yet identified • Despite the unknowns, EML4-ALK fusion protein is successfully inhibited by anticancer drugs https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4761370/ EML4-ALK fusion https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4561238/ https://sangakukan.jp/journal/journal_contents/2013/01/articles/1301-02-1/images/1301-02-1_fig_3.png Inversion produces EML4-ALK fusion gene EML4-ALK fusion protein Echinoderm microtubuleassociated protein-like 4 Anaplastic lymphoma kinase EML4-ALK fusion mutation testing https://issuu.com/iaslc/docs/alk-ros1_atlas_low-res Immunohistochemistry Fluorescence in situ hybridisation (FISH) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3432214/figure/Fig2/ a) EML4-ALK negative: red and green probes are close together (no inversion) FISH results from 3 patients b) and c) EML4-ALK positive: red and green probes are ‘broken apart’ (inversion has produced fusion protein) EML4-ALK is constitutively active (does not require ligand binding for activation) EML4-ALK tyrosine kinase activates proliferation and survival pathways by phosphorylation Tyr Tyr Tyr Tyr P P P P EML4-ALK fusion protein is constitutively active https://www.ncbi.nlm.nih.gov/pubmed/22010214 EML4-ALK inhibition Drug competitively binds the kinase domain ATP pocket to prevent ALK autophosphorylation https://www.ncbi.nlm.nih.gov/pubmed/22010214 Mutation, most commonly L1196M, confers resistance to crizotinib. Thought to be via steric hinderance EML4-ALK drug resistance https://www.ncbi.nlm.nih.gov/pubmed/22010214 Next generation ALK inhibitors • Ceritinib • Alectinib • Prevent ALK phosphorylation • Effective against L1196M https://www.videotranslation.net/staying-ahead-of-competition-in-the-market/ Future of lung cancer treatment • Lung cancer is currently still an area of serious unmet clinical need • 1 in 3 people live for more than a year after diagnosis • 5% of patients survive for 10 years or more • Hope lies with new technologies: more tailored diagnoses and personalised treatments and care http://www.personalisedmedicineappg.org/about https://www.england.nhs.uk/wp-content/uploads/2016/09/improving-outcomes-personalised-medicine.pdf The future of personalised medicine NHS England This leaflet was made in 2016 https://www.youtube.com/watch? v=mecZNDgXtzM Population genetics The genetic composition (gene pool) of populations Natural selection is an important mechanism of evolution. But is it the only mechanism? Nope! In fact, sometimes evolution just happens by chance. In population genetics, evolution is defined as a change in the frequency of alleles (versions of a gene) in a population over time. So, evolution is any shift in allele frequencies in a population over generations – whether that shift is due to natural selection or some other evolutionary mechanism, and whether that shift makes the population better-suited for its environment or not. In this article, we’ll examine genetic drift, an evolutionary mechanism that produces random (rather than selection-driven) changes in allele frequencies in a population over time. What is genetic drift? Genetic drift is change in allele frequencies in a population from generation to generation that occurs due to chance events. To be more exact, genetic drift is change due to “sampling error” in selecting the alleles for the next generation from the gene pool of the current generation. Although genetic drift happens in populations of all sizes, its effects tend to be stronger in small populations. Let’s make the idea of drift more concrete by looking at an example. As shown in the diagram below, we have a very small rabbit population that’s made up of 50 5050 – 50 5050 (or else you might suspect you have a doctored coin)! Allele benefit or harm doesn’t matter Genetic drift, unlike natural selection, does not take into account an allele’s benefit (or harm) to the individual that carries it. That is, a beneficial allele may be lost, or a slightly harmful allele may become fixed, purely by chance. A beneficial or harmful allele would be subject to selection as well as drift, but strong drift (for example, in a very small population) might still cause fixation of a harmful allele or loss of a beneficial one. [How is genetic drift different from natural selection?] The bottleneck effect The bottleneck effect is an extreme example of genetic drift that happens when the size of a population is severely reduced. Events like natural disasters (earthquakes, floods, fires) can decimate a population, killing most individuals and leaving behind a small, random assortment of survivors. The allele frequencies in this group may be very different from those of the population prior to the event, and some alleles may be missing entirely. The smaller population will also be more susceptible to the effects of genetic drift for generations (until its numbers return to normal), potentially causing even more alleles to be lost. How can a bottleneck event reduce genetic diversity? Imagine a bottle filled with marbles, where the marbles represent the individuals in a population. If a bottleneck event occurs, a small, random assortment of individuals survive the event and pass through the bottleneck (and into the cup), while the vast majority of the population is killed off (remains in the bottle). The genetic composition of the random survivors is now the genetic composition of the entire population. The founder effect is another extreme example of drift, one that occurs when a small group of individuals breaks off from a larger population to establish a colony. The new colony is isolated from the original population, and the founding individuals may not represent the full genetic diversity of the original population. That is, alleles in the founding population may be present at different frequencies than in the original population, and some alleles may be missing altogether. The founder effect is similar in concept to the bottleneck effect, but it occurs via a different mechanism (colonization rather than catastrophe). Unlike natural selection, genetic drift does not depend on an allele’s beneficial or harmful effects. Instead, drift changes allele frequencies purely by chance, as random subsets of individuals (and the gametes of those individuals) are sampled to produce the next generation. Every population experiences genetic drift, but small populations feel its effects more strongly. Genetic drift does not take into account an allele’s adaptive value to a population, and it may result in loss of a beneficial allele or fixation (rise to 100 % 100%100, percent frequency) of a harmful allele in a population. The founder effect and the bottleneck effect are cases in which a small population is formed from a larger population. These “sampled” populations often do not represent the genetic diversity of the original population, and their small size means they may experience strong drift for generations. Definitions • Alleles are different forms of a gene • Humans inherit one allele from each parent • Possible genotypes for that locus are: – Homozygous (AA or aa) – Heterozygous (Aa) • Genotype shown is Aa A a Homologous pair of chromosomes Locus (position of gene on the chromosome) Punnett squares By Source (WP:NFCC#4), Fair use, https://en.wikipedia.org/w/index.php?curid=53511831 Reginald Punnett 1875-1967 Both parents heterozygous (Aa) A A a a AA Aa Aa aa P a r e n t 2 Parent 1 Probability • Probability is a measure of how likely it is that something will happen • Probability is always between 0 and 1 Impossible for it to happen Certain it will happen 0 1 https://pixabay.com/en/pigs-fly-funny-hog-piggy-wings-1520968/ https://pixabay.com/en/piglet-young-animals-pig-small-2782611/ Chance that any pig can fly Chance that any pig is an animal Probability • You toss two coins at the same time • The probability of getting all heads ½ x ½ = ¼ or 0.5×0.5=0.25 http://markread.info/2013/11/cutting-edge/ https://www.mathsisfun.com/data/probability-events-independent.html • You toss a fair coin • The probability of getting a head is 50% or ½ or 0.5 • The probability of getting a head or a tail is 100% or 1 • You toss three coins at the same time (or the same coin three times) The idea that landing heads the on the first throw will make tails more likely on the second is known as gamblers fallacy and is false • Hardy-Weinberg equilibrium (also called principle, model, theorem, law) • Hardy-Weinberg equation used to calculate the frequency of genotypes in a population • Population change is measured by changes in genotype frequency • Traditional method of calculating frequency of disease alleles in a population Hardy-Weinberg Genotype frequency • In a live Lego population 40/200 people have white legs phenotype • The Lego alleles for leg colour are: – Dominant allele R (red legs) – Recessive allele r (white legs) • All possible genotypes (allele combinations) in the population: RR, Rr, rR, rr • Genotype for white legs is rr • We can deduce that the frequency of rr genotype is 40/200 = 0.2 • We cannot deduce the frequency of RR and Rr genotypes from the phenotype • We need Hardy-Weinberg for this! Red leg phenotype could result from RR or Rr genotype White leg phenotype only results from rr genotype Hardy-Weinberg equilibrium The frequency of alleles in a population remain unchanged (generation after generation after generation) provided certain conditions are met: • Random mating (certain traits are not chosen) • Large population • No immigration or emigration (no one arrives or leaves the population) • No mutation • No natural selection (all genotypes are equally viable and fertile) • No overlapping generations Hardy-Weinberg equilibrium • Real populations do not remain constant in this way, so why is Hardy-Weinberg equilibrium useful? • We can measure genotype changes in a real population by calculating their deviation from a theoretical unchanging population Hardy-Weinberg equation p 2 + 2pq + q2 = 1 Allele frequency: p + q = 1 • Frequency of the dominant allele in a population: p • Frequency of the recessive allele in a population : q • Everyone in the population must have alleles p or q • Sum of all possible outcomes must =1 (100%) • Therefore allele frequency: p + q = 1 Dominant allele Recessive allele p q • Everyone in the population must have alleles p or q • All possible genotypes (allele combinations) in the population are pp, pq, qp, qq • Frequency of allele 1: p + q = 1 • Frequency of allele 2: p + q = 1 • Genotype frequency: (p + q)(p + q) = 12 Genotype frequency: p2 + 2pq + q2 = 1 Genotype = two alleles Dominant allele Recessive allele p q (p + q)(p + q) = 1 pp + pq + qp + qq = 1 p 2 + 2pq + q2 = 1 Using the Hardy-Weinberg equation p 2 + 2pq + q2 = 1 Frequency of homozygous dominant genotype Frequency of homozygous recessive genotype Frequency of heterozygous genotype Alleles: pp + pq + qp + qq = 1 Using the Hardy-Weinberg equation calculate the frequencies of all leg colour alleles and genotypes in the live Lego population Representative 10% of live Lego population Lego population allele frequencies • 40/200 people have white legs phenotype (rr genotype) • rr genotype frequency: q2 q 2 = 40/200 = 0.2 q = = 0.45 r = 0.45 • Allele frequency: p + q = 1 p = 1 – 0.45 = 0.55 R = 0.55 Dominant allele Recessive allele p R (red legs) q r (white legs) Useful information • rr genotype frequency (homozygous recessive) = q2 = 0.2 • RR genotype frequency (homozygous dominant) = p2 = (0.55)2 = 0.3 • Rr genotype frequency (heterozygous) = 2pq = 2 x 0.55 x 0.45 = 0.5 Lego population genotype frequencies Dominant allele Recessive allele p R (red legs) q r (white legs) Useful information Lego population data Allele frequency p (R) q (r) 0.45 0.55 Genotype frequency 0.3 0.2 0.5 q 2 (rr) p 2 (RR) pq (Rr) Dominant allele Recessive allele p R (red legs) q r (white legs) Useful information Data on leg colour can be recalculated over time to track changes in the population Influences on populations in real life • Mutation • Natural selection • Migration • Non random mating • Genetic drift oFounder effect oBottleneck effect Mutation • Change in DNA sequence • Source of new alleles (genetic diversity) in the gene pool of a population • Not all mutations are passed on to the next generation: they must be in germ line cells to be passed on Natural selection By The National Heart, Lung, and Blood Institute (NHLBI) – http://www.nhlbi.nih.gov/health/health-topics/topics/sca/, Public Domain, https://commons.wikimedia.org/w/index.php?curid=19198765 • Organisms better adapted to their environment survive and produce more offspring – Charles Darwin • Sickle cell disease homozygotes produce sickle cell haemoglobin resulting in anaemia and pain • Normal homozygotes produce no sickle cell haemoglobin • Heterozygotes produce both sickle cell haemoglobin and normal haemoglobin https://en.wikipedia.org/wiki/Tay %E2%80%93Sachs_disease#/media/ File:Autorecessive.svg • The malaria parasite flourishes less well in the blood when sickle cells are present • This confers malarial resistance to heterozygotes • Before malaria treatment, heterozygotes were more likely to survive and produce offspring • This survival advantage has kept the sickle cell allele in the population leading to high incidence of sickle cell disease Migration (gene flow) • Movement from one population to another • Can change allele frequencies in populations • Creates diversity By Jessica Krueger – Own work, CC BY-SA 3.0, https://commons.wikimedia.org/w/index.php?curid=19542551 HH genotype hh genotype Heterozygous Hh genotype due to migration Non random mating • The probability that two individuals in a population will mate is not the same for all possible pairs • Assortative mating: Individuals mate with others who are phenotypically similar (look like them) • Inbreeding: Mating between related individuals Genetic Drift • Change in allele frequency in a population over time • Random changes in the population that may or may not be beneficial • Occurs in populations of all sizes but effect is more prevalent in smaller populations • A harmful allele could potentially reach 100% frequency (fixation) or a beneficial allele could be lost from the population • Bottlenecking and the founder effect increase the influence genetic drift has on allele frequency in a population Founder effect By Founder_effect.png: User:Qz10derivative work: Zerodamage – This file was derived from Founder effect.png:, Public Domain, https://commons.wikimedia.org/w/index.php?curid=20570109 Large original population Smaller groups start new smaller colonies The new population may genetically represent the original population The new population may lose the diversity of the original population • A new isolated group may not represent the diversity of the original population • For example: If the founder(s) carry a disease allele, an unusually high instance of genetic disease may result in the new population • In the Ashkenazi Jewish population: Higher instance of TaySachs disease (TSD). Carrier incidence is 1:30 • 1:4000 births versus 1:320 000 in wider population • Devastating disorder. Most patients die by the age of 4 years Founder effect http://slideplayer.com/slide/4583415/ By Jonathan Trobe, M.D. – http://www.kellogg.umich.edu/theeyeshaveit/congenital/tay-sachs.html, CC BY 3.0, https://commons.wikimedia.org/w/index.php?curid=16368165 https://en.wikipedia.org/wiki/Tay%E2%80%93Sachs_disease#/media/File:Autorecessive.svg Bottlenecking • Significant portion of population wiped out by random environmental event • Reduction in population size: new population may not genetically represent the original • For true bottleneck the chance of survival for individuals must be the same (survival does not depend on individual genetic traits) • Survivor genotypes will be passed to offspring • Population allele frequencies change https://futureoftheocean.wordpress.com/tag/genetic-bottleneck/ Environmental Event Bottlenecking Random environmental Event, wipes out significant portion of population Surviving individuals did so purely by chance The surviving members alleles are now overrepresented in the new population From the Amoeba Sisters YouTube: 5 minute video on genetic drift (highly recommended) https://www.youtube.com/watch?v=W0TM4LQmoZY Original population genotypes: BB, Bb, bb New population genotypes: Bb, bb Breast cancer Breast cancer is the most common cancer in women. Prostate cancer is the most common in men. (UK new diagnoses in 2015.) Breast cancer • In the UK, 1 in 8 women is likely to develop breast cancer at some time in their life • Most cases are sporadic (caused by genetic mutations that are not inherited) Hereditary breast cancer 5-10% of breast cancers are hereditary Characteristics: • Clusters in families ‒ Families with both breast and ovarian cancer ‒ Families with male breast cancer ‒ Lower age of onset ‒ Bilateral cancer Mutation of BRCA1 and BRCA2 genes • The most common known cause of hereditary breast cancer is mutation of BRCA1 or BRCA2 • These two genes account for approximately 20% of familial breast cancers. Research to identify new genes that also contribute to a high risk of breast cancer is ongoing. Facts and figures • BRCA1 gene • 17q21.31 • 24 exons • 100kb genomic DNA • 100s mutations identified • BRCA1– tumour suppressor gene • DNA repair • BRCA2 – gene • 13q13.1 • 28 exons • 70kb genomic • BRCA2 – tumour suppressor gene • DNA repair BRCA1 and BRCA2 facts and figures https://www.youtube.com/watch?v=-GwdZIqJf8g BRCA1 and BRCA2 mutation increase the risk of developing certain types of cancer Ovarian cancer Early age onset breast cancer Second primary breast cancer Prostate cancer Male breast cancer BRCA1/2 inheritance is autosomal dominant Autoso mes Gene can be inherited from either parent 50% chance of inheriting the gene if a patent is positive One mutated allele (copy of the gene) confers increased risk https://en.wikipedia.org/wiki/ Tumour suppressor genes Single mutation inactivates gene on one allele Second mutation inactivates gene on second allele Enough tumour suppressor protein is produced• Tumour suppressor gene mutations are deactivating mutations called ‘loss of function’ (e.g. the mutation stops the encoded protein being produced) • Tumour suppressor gene mutations are recessive: mutation of both copies is needed to prevent production of the tumour suppressor protein Figure 23-24 Albt• BRCA1/2 inheritance is dominant because one mutated allele (copy of the gene) confers increased risk • Loss of tumour suppressor protein is recessive because both genes must be mutated to prevent production of the tumour suppressor protein Tumour suppressor genes Tumour suppressor gene + function of both alleles lost = protein that supresses proliferation is not produced Tumour suppressor gene inactivation is analogous to having no brakes (unable to stop cell division) BRCA1 and BRCA2: Genetic predisposition to cancer • Breast cancer is more common in women than in men, but the mutated gene can be inherited from the mother or father • One copy of the altered gene increases the chance of developing cancer • People inherit an increased likelihood of developing cancer • Not everyone who inherits the mutation of BRCA1 or BRCA2 will ultimately develop cancer Knudson’s two-hit hypothesis Cancer BRCA1 and BRCA2 and cancer risk https://www.nytimes.com/2 013/05/14/opinion/my-medi cal-choice.html Royal Marsden NHS Foundation Trust 2014 Average cancer risk with BRCA1 or BRCA2 mutation compared to no BRCA mutation Ashkenazi Jewish population Ashkenazi Jewish population • Study of specific mutations in Ashkenazi Jews • Combined prevalence of BRCA1/2 mutation is 2.6% as opposed to 0.2% in the general USA population • Three founder mutations (due to common ancestral origins and endogamy) have been identified at a higher frequency than the other BRCA1 or BRCA2 gene mutations • BRCA1: 187delAG • BRCA1: 5385insC • BRCA2: 6174delT • About 78 to 96% of Ashkenazi Jews with BRCA1/2 mutations carry one of the founder mutations • Founder mutations provide a highly efficient means of determining carrier status (geneticists know which mutationstolookfor) Case study: the Wilson family • Wendy Wilson saw a television program about familial breast cancer • Became concerned about her own family • Her mother had breast cancer and died aged 42 • 3 other relatives had breast cancer including her aunt (aged 40) and cousin (age 36) and a male second cousin • Wendy was referred by her GP for genetic testing Breast cancer gene carried but disease not developed Not related as all breast cancer is on Wendy’s mother’s side of the family The Wilson pedigree The Wilson pedigree Mutation testing • Tumour tissue from Wanda (Wendy’s mother) was obtained from pathology lab archive and DNA extracted • Deletion in exon 18 of BRCA2 was found. This caused a frameshift creating a stop codon • To confirm this was the ‘first hit’ mutation Wanda’s sister (Wendy’s aunt) was contacted for a blood sample. She also carried this mutation • Family mutation was identified • Other family member blood samples were tested • Veronica and William carried the mutation but Wendy did not Mutation testing Genetic counselling for female with no BRCA2 mutation: Wendy • Important for her to realise that she could still develop sporadic forms of breast cancer • She should still attend the standard mammogram screening program • Risk is strongly influenced by lifestyle – reduce risk by 40% by: • Maintaining a healthy weight • Physical exercise • Healthy diet • Not smoking • Reducing alcohol consumption Genetic counselling for BRCA2 mutation carrier (female): Veronica • Carried mutation so at high risk of developing breast cancer • Increased risk of ovarian cancer • Options • Do nothing • Lifestyle changes • Enhanced surveillance program – annual mammography • Tamoxifen – may reduce risk • Prophylactic mastectomy (breast removal) • Prophylactic salpingectomy (removal of ovaries and fallopian tubes) Genetic counselling for BRCA2 mutation carrier (male): William • Breast cancer is very rare in males so although he is a carrier his absolute risk is low • Increased risk of prostate cancer – attend regular screening • His daughters would need counselling (plus testing if they choose) as they are at substantial risk of breast cancer • If they inherit the gene his sons are at increased risk of prostate cancer and risk passing the mutation onto their children What is the human genome? The complete set of human genes plus all the non-coding DNA nucle us Courtesy: National Human Genome Research Institute Mitochondrial DNA in circular molecules ~16 thousand base pairs (sequenced 1981)https://commons.wikimedia.org/w/index.php? curid=53240683 Nuclear DNA in chromosomes ~3 billion base pairs Composition of the human genome Human genome is 1-2% protein coding genes https://upload.wikimedia.org/wikipedia/commons/a/ad/ Components_of_the_human_genome.png NIH says 1% What is the Human Genome Project? • Project to sequence the whole human genome 1990-2000 • Goals of the project (ongoing) • Obtain the sequence of all nucleotides (ATGC) that make up human DNA • Identify all genes in human DNA • Store all the data on databases and create tools to analyse the information • Address ethical, legal and social issues arising from the project International collaborative research program • Conducted by thousands of scientists from 6 countries • Landmark in international cooperation in biological science. • Original paper: “Initial sequencing and analysis of the human genome” of ~2900 authors – currently the most co-authored paper in biological sciences https://www.yourgenome.org/stories/who-was-involved-in-the-human -genome-project Team from The Sanger Centre, Cambridge, UK https://www.researchgate.net/publication/311545862_Supplementar y_Information_for_Initial_Sequencing_and_Analysis_of_the_Human_ Genome_Nature_V412_565 A complete list of the authors can be found here: Collaborators 1. Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridgeshire, UK 2. Broad Institute/Whitehead Institute/MIT Center for Genome Research, Cambridge, Massachusetts, USA 3. Washington University School of Medicine Genome Sequencing Center, St. Louis, Missouri, USA 4. Joint Genome Institute, US Department of Energy, Walnut Creek, California, USA 5. Baylor College of Medicine Human Genome Sequencing Center, Department of Molecular and Human Genetics, Houston, Texas, USA 6. RIKEN Genomic Sciences Center, Yokohama-city, Japan 7. Genoscope and CNRS, UMR-8030, Evry Cedex, France 8. Genome Therapeutics Corporation (GTC) Sequencing Center, Genome Therapeutics Corporation, Waltham, Massachusetts, USA 9. Department of Genome Analysis, Institute of Molecular Biotechnology, Jena, Germany 10. Beijing Genomics Institute/Human Genome Center, Institute of Genetics, Chinese Academy of Sciences, Beijing, China 11. Multimegabase Sequencing Center, The Institute for Systems Biology, Seattle, Washington, USA 12. Stanford Genome Technology Center, Stanford, California, USA 13. Stanford Human Genome Center and Department of Genetics, Stanford University School of Medicine, Stanford, California, USA 14. University of Washington Genome Center, Seattle, Washington, USAKEY 15. Department of Molecular Biology, Keio University School of Medicine, Tokyo, Japan 16. University of Texas Southwestern Medical Center at Dallas, Dallas, Texas, USA* 17. University of Oklahoma’s Advanced Center for Genome Technology, Department of Chemistry and Biochemistry, University of Oklahoma, Norman, Oklahoma, USA 18. Max Planck Institute for Molecular Genetics, Berlin, Germany 19. Cold Spring Harbor Laboratory, Lita Annenberg Hazen Genome Center, Cold Spring Harbor, New York, USA 20GesellschaftfürBiotechnologischeForschungmbH(GBF)https://en.wikipedia.org/wiki/M ain_Page https://www.europeancitiesma rketing.com https://www.yourgenome.org/stories/who-was-involved-in-the-hu man-genome-project Funding and costs • The vast majority of the project was paid for by US Taxpayers from the Department of Energy and US National Institutes of Health budgets • Contributions were made by the UK from the Medical Research Council and the Wellcome Trust • Final cost $2.7 billion https://pixabay.com/en/dna-string-biology-3d-1811955/ Human Genome Project sequencing Human Genome Project sequencing • The haploid genome was sequenced https://science.howstuffworks.com/life/cellularmicroscopic/cell6.htm • Bases are paired so only one DNA strand needed to be sequenced https://commons.wikimedia.org/wiki/ File:Haploid,_diploid_,triploid_and_tetraploid.svg Genetic analysis in the early 2000s http://cgil.uoguelph.ca/QTL/ABI377.htm http://cgil.uoguelph.ca/QTL/ABI377.htm https://users.ugent.be/~avierstr/principles/seq.html International Human Genome Sequencing Consortium: sequencing technique 2001 Nature Publishing Group, International Human Genome Sequencing Consortium, Initial sequencing and analysisofthehumangenomeNature409860–921 Genomic DNA Many men and women donated blood for the HGP DNA extracted from white blood cells It is not known which DNA sample(s) were used for sequencing Genomic DNA Organised mapped large fragments (clone contigs) By sequencing out of the known BAC sequence the ends of the genomic DNA can be sequenced The large fragments can be matched end to end in order Where can the DNA sequence be found? http://www.sanger.ac.uk/resources/downloads/ human/ Whole genome sequencing https://www.genome.gov/images/illustrations/sequencHuman Genome Project reference sequence Compare person’s generated sequence to reference sequence to identify differences “$1000 Genome” Grants • “$1000 Genome” Grants issued by the National Human Genome Research Institute since 2004 have kept up the momentum of genomic research • $230 million dollars awarded to 97 groups of academic and industrial scientists • This has helped start a number of genomics companies and develop new sequencing methods https://www.nature.com/news/technology-the-1-00 0-genome-1.14901 • Current costs are estimated around $1000-$2000 • Companies have reported to have been able to sequence a human genome for $1000 or less • May not include operational and labour costs • May not represent costs to the customer Cost per genome https://www.genome.gov/sequencingcosts/ https://www.genome.gov/27565109/the-cost-of-sequencing -a-human-genome/ Ethical, Legal and Social Implications (ELSI) of the Human Genome Project ELSI • Set up 1990 • Allocated 3-5% of the Human Genome Project budget Aims: • Privacy and fair use of genetic information • Informed consent • Medical use of new genetic technologies (Clinical Integration) • Education https://www.genome.gov/pages/research/der/elsi/ erpegreportpdfhttps://www.genome.gov/10001618/the-elsi-research-program/ ELSI Mission statement: “To identify, analyze, and address the ethical, legal and social implications of the Human Genome Project (HGP) at the same time that the basic scientific issues are being studied” Bermuda principles 1996 • 1996 meeting of leaders of The Human Genome Project • Agreement that all sequences will made freely available in the public domain within 24 hours • To maximise benefits to society • Reshaped practices in the whole field • Standard practice in research is for small independent groups to publish data https://unlockinglifescode.org/timeline?ti Privacy and fair use of genetic information • Public policies created to protect genetic privacy and prevent discrimination (informed by ELSI research) • Reduce likelihood of genetic discrimination (insurers and employers) • Reduce misuse/misinterpretation of genetic information https://www.genome.gov/pages/research/der/elsi /tdfhttp://www.genewatch.org/sub-396521 Informed consent • Ensure everyone participating in research is properly informed (participants must know in advance what will happen to their samples and who will find out information about them) • Research must be designed, conducted and reported in an ethically sound manner http://www.genewatch.org/sub-396522 https://www.genome.gov/pages/research/der/elsi/er Medical use of new genetic technologies (Clinical Integration) • Research plus healthcare • Ensure new technologies developed as a result of the Human Genome Project are safe, fair and effective for patients • Safe, timely, effective, efficient, equitable, and patient-focused http://chn4kids.org/category/clinical-integration/ https://www.genome.gov/pages/research/der/elsi/erphttps://www.genome.gov/10001727/erpeg-final-repor Education • ELSI hope to educate as many people as possible of all ages including professionals, health workers and members of the public • Make people aware of the Human Genome Project and future research (clinicians and scientists want people to understand and participate in research) • Developed online educational resources https://www.genome.gov/25019879/onlin e-education-kit-understanding-the-humangenome-project/ https://www.genome.gov/pages/research/der/elsi/ erpegreport.pdf Basic understanding of the Human Genome Project • Short educational videos for better understanding : https://www.youtube.com/playlist?list=PLF0701633C 91835BF https://www.genome.gov/human-genome-project/Co mpletion-FAQ 100 000 Genomes Project • Funded by UK Department of Health • Run by Genomics England • Aims: 1. Set up the first NHS genomic medicine service 2. Ensure ethical transparent consent of patients 3. Gain scientific and medical knowledge 4. Encourage a UK genomics industry • 50 000 cancer genomes (patients) • 50 000 rare disease genomes (patients plus relatives) • Rare disease affect 3 million people in UK (there are 5000-8000 rare diseases) • Hope to find diagnosis and treatment 100 000 Genomes Project DNA DNA Patient’s normal cells Patient’s cancer cells Compare sequences to find cancer mutation https://commons.wikimedia.org/wiki/ 100 000 Genomes Project: 50 000 cancer genomes https://www.genomicsengland.co.uk/the-100000-genomes-project/underst anding-genomics/8335-2/ PALB2 mutation • 60% chance of developing cancer • 50:50 chance they will pass the mutation to children •4thsistercarriesmutation4 sisters, 3 diagnosed with breast cancer, no BRCA mutation https://www.youtube.com/watch?v=BMw0nfIDixM 100 000 Genomes Project: 50 000 rare disease genomes Leopard syndrome (Noonan’s Syndrome) If testing had been available the family would have been prepared for the treatments and surgeries needed Since testing they have had support from other families and know more about what the future holds 100 000 Genomes project: 50 000 rare disease genomes https://www.youtube.com/watch?v=hxou7ayQSZQ • Epilepsy and mobility problems • Without genetic analysis there is a journey of trial and error to find a treatment that works best • Genome sequencing showed: • Glut1 mutation • Not found in either parent Knowledge disorder is not inherited if family have another child Specific treatment Panel of clinicians and scientists discuss direct to consumer tests Listen to a recording of the discussion or read the article Self study is needed for first class marks Direct to consumer genetic testing https://www.bmj.com/content/367/bmj.l5688.abstract

Entrepreneurial or academia’s scientist.

Entrepreneurial or academia’s scientist. It is well-known fact that GPs prescribe placebos to patients’ A scientific article that supports the use of placebos in treating pain is “The Placebo Effect in Pain Management: A Systematic Review and Meta-Analysis” by K.M. Wiech et al. (2017). This article reviews the evidence for the efficacy of placebos in treating pain and concludes that placebos can be an effective treatment option for some patients. There are multiple examples of how homeopathy & placebos can reduce pain. The aim is to develop and deliver to patients new therapeutical approaches & procedures to heal the pain. Understanding, and utilizing patients’ rituals and uncounsiess beliefs use Cognitive Behavioural Therapy and then Neuro-Linguistic Programming as a programming language for the mind not to cope but overwrite pain as it is done in PTSD. Usage of physical Placebos as “fetish” to increase the success ratio of pain reduction therapy. Preparation of “psychotherapy in the box” should induce feeling relax and relive. All will be done without the presence of a therapist in the room. There is consideration of adopting the Artificial Intelligence model as a patient-therapist. Not in a way of treating pain but as a hypnotic trance inducer. In this approaches all of the know techniques successful in reducing pain will be used. Of course, Breathing techniques with prolonged exhale will be adopted. In shortcut: Patient will be exposed to “boxed psychotherapy” content. This unique content will provide a survey and contain the full procedures for patients to follow up. The first stage will be completed if the survey. A patient will be convinced that a survey exists to assess the level of pain. And prepare the most appropriate way to reduce pain. The patient will gather instructions that after completion of the survey will get a personalized plan to treat pain. It will feel up the gap that GPs do not have enough time to spend with their patients and screen them appropriately. Multiple questions will have many roles. The main one stay unchanged. Every single question will step by step induce the patient into trans. After completion of the survey, the patient will not know the level of his pain. Rather recall previous experiences associated with relief. These questions individually and combined together should convince the patient that the final step of swallowing the placebo will provide ease and relax. The real aim of the survey is not to assess the level of pain. The aim is to induce dominos clues to induce a positive analgesic effect at every further step. All questions will be carefully selected to induce desirable state patients’ state. Confirmation of BIAS associated with swallowing pills will be the peak moment of therapy. Remainder to swallow another placebo aims to recall questions and visions from the survey. Pills in a singular blister will have four different shapes and four different colors. Every patient action due to the process aims to induce a placebo effect. It will be done with the usage of multiple clues Pavlovian conditioning and cultural context appropriate to the country.

Writing a dissertation about neuropathic pain is an important and timely topic. Neuropathic pain is a debilitating condition that affects millions of people worldwide, and there is a need for more effective treatments. The proposed dissertation could provide valuable insight into the potential of using placebo effects & behavioral protocols to reduce pain or match patients with a high rate of positive response to placebo/homeopathy. The research will improve the quality of life for those suffering from neuropathic pain, and could potentially lead to new treatments and therapies. The most interesting scientific question I would like to answer is: Is this possible to induce an analgesic effect by adopting Pavlovian conditioning? I assume that answer should be yes. It is possible to induce an analgesic opioid effect by adopting Pavlovian conditioning. This type of conditioning involves pairing a neutral stimulus with a drug that produces an analgesic effect, such as an opioid. Over time, the neutral stimulus can become associated with the analgesic effect, and can produce a similar effect without the need for the drug. Is this possible to induce analgesic effect with adopting placebo as inert substance? Here an answer is also yes. It is possible to induce an analgesic effect by adopting a placebo as an inert substance. Placebo treatments have been shown to be effective in reducing pain in some patients and can be used as a viable treatment option for neuropathic pain. Furthermore is this possible to gain an analgesic effect by using just text and imagination or Neuro Linguistic programming? Yes, it is possible to gain an analgesic effect by using just text and imagination or Neuro-Linguistic Programming (NLP). NLP is a form of psychotherapy that uses language and imagination to help people change their thoughts and behaviors. It has been used to help reduce pain in some patients and can be an effective treatment option for neuropathic pain. Furthermore is this possible to gain analgesic effect by usage just text and immaginations or Neuro Linguistic programming? Yes, it is possible to gain an analgesic effect by using just text and imagination or Neuro Linguistic Programming (NLP). NLP is a form of psychotherapy that uses language and imagination to help people change their thoughts and behaviors. It has been used to help reduce pain in some patients, and can be an effective treatment option for neuropathic pain. I would like to combine all of the know techniques to induce a positive patient response to inert substances. Those will include multidisciplinary approach techniques associated with Cognitive Behavioural Therapy, Exposure Therapy, Brainspoting, NLP, and breathing techniques. Also, subliminal techniques will be adopted to induce a desirable patient state. All Sessions aim for a maximum of 90 minutes to complete all of the steps of “boxed psychotherapy” with the culmination of swallowing pills and/or setting the remainder in a smartphone to swallow the next dosage. also, all the processes will be engaging and interesting thus it will be designed with a Hollywood Screenplay recipe. My Background According to neuropathic pain dissertation: • Therapist / CBT Cognitive Behavioural Therapy NVQ3. • Therapist / EMDR Eye Movement Desensitisation and Reprocessing Therapist NVQ3 • Counsellor / NVQ3. • Diploma in Pharmacy Technician. All of the above qualifications were obtained with distinctions.

BIOM2004 W2 Lecture 2

Introduction to the Immune System

Dr R Furmonaviciene

• Please choose the best definition of Immune System :
• Immune system is composed of organs, cells and cellular networks;
• Immune system is composed of organs, cells and antibodies;
• Immune system is composed of organs, cells and sub-cellular structures

BIOM2004 W1

Revision MCQ:

• Learning Outcomes:
• Discuss the key events of an immune response to bacterial invasion
• Compare and contrast innate and adaptive immunity
• Actively participate in pre-session, during-session and post-session learning; to start using OneClass Notebook (see Blackboard)

BIOM2004 W2 Lecture 2

Antigens

Immune system is activated by danger signals

Immune system is activated by molecular patterns

Viruses and bacteria invade by using their surface proteins to attach to host cells or they produce proteins and hydrophobic molecules like LPS to damage host cells

Proteins and other molecules which activate immune system are called antigens

Cells involved in immune response recognise antigens by using their receptors

Receptors usually bind to small areas of antigens, called epitopes

Antigens

This Photo by Unknown Author is licensed under CC BY

Summarise key events here:

Example of an Immune Respose:

What Happens When We Get a Splinter?

Summarise key events here:

Splinter and

Bacterial Invasion

Splinter

The barrier of skin is damaged

The cells are injured

The splinter is covered in bacteria

Bacteria can easier enter the tissues and blood stream

Danger signals will attract immune cells

Innate and possibly adaptive immune response will be initiated

Defensins, phagocytes and dendritic cells may be activated

T cells and B cells may participate in defense

Immune memory cells may be formed

Bacteria gets eliminated

Tissues heal

Immune response stops

Example of an Immune Respose:

What Happens When We Get a Splinter?

Key Events in More Detail

Antigen presentation

MHC class molecules on dendritic cells pick up antigenic peptides and

present them to T cells waiting in the lymph nodes;

This activates T cells and they enter blood stream and travel to the site of infection to clear the pathogens

B Lymphocytes are also activated in the lymphnode.

When informed about danger and activated, T cells form clones (or groups of identical T cells with the right specificity)

T helper cells inform B cells, and B lymphocytes also form clones.

Effective Immune Response

After the infection is cleared, immune response needs to be switched off (autoimmune diseases may result if this is not happening)

Memory cells are left after the infection is cleared, so that immune system can remember pathogen and react faster next time this pathogen comes across

Therefore secondary immune response (response to a seen pathogen) is stronger than primary response (response to a new pathogen)

Phases of an Immune Response

Primary and Secondary Immune Response

Innate and Adaptive Immunity

Compare and contrast Innate and Adaptive immunity

Adaptive immune responses develop later and consist of activation of lymphocytes. The kinetics of the innate and adaptive immune responses are approximations and may vary in different infections.

Innate and adaptive immunity

Cellular

Immune

response

Humoral

Surprise Task: Which Splinter is Better: Glass Splinter or Wooden Splinter?

Innate and Adaptive Immunity:

How Immune Response is Switched Off?

Task:

Read the following paper

https://www-proquest-com.proxy.library.dmu.ac.uk/docview/2434147450?OpenUrlRefId=info:xri/sid:summon&accountid=10472

Damage-associated molecular patterns in trauma

Borna, Relja; Land Walter Gottlieb.European Journal of Trauma and Emergency Surgery; Heidelberg Vol. 46, Iss. 4,  (Aug 2020): 751-775. DOI:10.1007/s00068-019-01235-w

and answer the question below:

How Can Danger-Associated Molecular Patterns (DAMPs) promote tissue healing?

Please place your answer in OneClass Notebook on Blackboard

Can you briefly explain the picture?

Immune system is regulated by stimulating and suppressive molecular patterns

Activation of Immune System

We are constantly surrounded

• by bacteria
• viruses
• parasites

Activation of Immune System: Which Way to Go?

Post-Lecture Task

Read the following research paper and discuss briefly

The innate and adaptive events of immune response

to COVID-19.

https://www.frontiersin.org/articles/10.3389/fimmu.2020.01662/full

Optional catch-up time: text me via MS Teams

BIOM2004 W3 Lecture 3

Cytokines

Dr R Furmonaviciene

• Learning Outcomes:
• Discuss the definition and functions of cytokines
• Discuss briefly how cytokines can be dis-regulated
• Actively participate in pre-session, during-session and post-session learning; to start using OneClass Notebook (see Blackboard)

BIOM2004 W3 Lecture 3

Write your definition of Cytokines here:

Bite 1

Cytokines:

Groups and Functions

Soluble Mediators = cytokines

Membrane receptors and counter-receptors

How do cells communicate?

stimulus

Cytokine gene

Cytokine

Cytokine Receptor

Gene activation

Cytokine-producing cell

Target cell

Biological effects

Autocrine action

Paracrine action

Endocrine action

Circulation

Cytokine effects

Activated macrophage

IL-12: activates NK cells, induces differentiation of CD4+ Th cells into Th1 cells

IL-8: Chemotactic factor – recruits neutrophils, basophils and T cells to site of infection

Systemic Effects

Local Effects

IL-1: Activates vascular endothelium and lymphocytes Local tissue destruction and increases access of effector cells into tissue

TNF: Activates vascular endothelium and increases vascular permeability – increased entry of IgG complement and cells to tissue and increase drainage to lymph nodes

IL-6: Lymphocyte activation and increased antibody production

IL-1: Fever and production of IL-6

TNFa: Fever, mobilisation of metabolites, shock

IL-6: Fever, acute-phase protein production

Inflammatory cytokines

Cytokine definition

Cytokine is the general term for a large group of molecules involved in signalling between cells during immune responses. Cytokines signal between lymphocytes, phagocytes, and other cells of the body.

• All cytokines are proteins or glycoproteins
• The different cytokines fall into a number of categories. The principal subgroups are: interferons, interleukins, chemokines and colony-stimulating factors.

Main functions of cytokines

• Stimulators of immature lymphocyte growth and differentiation
• Mediators of natural immunity
• Regulators of mature lymphocyte activation, growth and differentiation
• Regulators of immune-mediated inflammation

Cytokine redundancy

• Redundant = different cytokines may have the same function, e.g.:

Cytokine pleotropism

• Pleotropic = one cytokine having many functions, e.g.:

Cytokine regulation

• Production of antagonistic cytokines, e.g. IL-10 inhibits the synthesis of TNFalpha
• Production of dedicated inhibitor molecules, e.g. IL-1 receptor antagonist (IL-1ra) is produced by the same cells that secrete IL-1; IL-1 and IL-1ra compete for the same receptor
• Cytokines may be regulated by activating proteases, e.g. during activation the amino terminus of TGFbeta is removed to release the active form of the cytokine

Interferons

Interferons

• INTERFERONS LIMIT THE SPREAD OF CERTAIN VIRAL INFECTIONS. IFNs induce a state of antiviral resistance in uninfected cells. They are produced very early in infection and are important in delaying the spread of a virus until such time as the adaptive immune response has developed.
• one group of interferons (IFNα and IFNβ) is produced by cells that have become infected by a virus;
• another type, IFNγ, is released by activated Th1 cells.

Anti-virus cytokine response

Interferons (IFNs)

Induce resistance to viral replication in all host cells

Increase MHC Class I expression and antigen presentation in all cells

Activate NK cells to kill virus-infected cells

Virus-infected host cell

Interleukins

TCR

CD3

CD4

CD4+/T helper cell

TCR

CD3

CD4

Interleukin-2 (IL-2)

Interferon gamma (IFN)

TCR

CD3

CD4

Interleukin-5 (IL-5)

Interleukin-13 (IL-13)

Interleukin-4 (IL-4)

Th1 (T helper 1) – Cell mediated immune responses, e.g. intracellular bacteria, activate phagocytes

Th2 (T helper 2) – Humoral immune responses, e.g. IgE production, activate B cells

Cytokines can be used to define

T cell subsets

• INTERLEUKINS are a large group of cytokines produced mainly by T cells

CYTOKINE SECRETION FROM T-helper CELLS CONTROLS B CELL PROLIFERATION AND DIFFERENTIATION

B cell development is influenced by cytokines from T cells and APCs, and by direct interactions with Th2 cells. IL-4 is most important in promoting division, and a variety of cytokines including IL-4, IL-5, IL-6, IL-10, and IFNγ influence development into antibody-forming cells (AFCs).

Colony stimulating factors

Bone Marrow

Blood

Pluripotent hematopoietic stem cell

neutrophil

monocyte

GM-CSF

Granulocyte/ macrophage progenitor

M-CSF

G-CSF

Granulocyte/macrophage colony stimulating factor (GM-CSF)

Macrophage colony stimulating factor (M-CSF)

Granulocyte colony stimulating factor (G-CSF)

CS factors

• COLONY STIMULATING FACTORS (CSFs) DIRECT THE DIVISION AND DIFFERENTIATION OF LEUKOCYTE PRECURSORS

Chemokines

Chemokines

• Chemokines regulate normal cell traffic, tissue architecture, and inflammatory cell recruitment. The two largest chemokine families are designated CCL or CxCL, distinguished by the arrangement of their cysteine residues. CCL chemokines attract monocytes, lymphocytes and eosinophils. Most CxCL chemokines attract neutrophils, although some act on lymphocytes.
• CCL11 – Eotaxin – attract eosinophils
• CxCL8 – IL-8 – attracts neutrophils

Other cytokines

• OTHER CYTOKINES INCLUDE TNF α AND TNF β, AND TGF β

What Can Go Wrong with Cytokines?

Discuss an example of cytokine dis-regulation here:

How does cytokine storm start?

Toxic shock syndrome (cytokine storm)

This occurs due to overproduction of cytokine during bacterial infection. This condition may develop within few hours following infection (e.g. by E coli, Klebsiella pneumoniae, Neisseria meningitidis). The symptoms of septic shock include drop in blood pressure, diarrhea, fever and hemorrhagic blood clotting in various organs.

The reason for septic shock is bacterial endotoxins stimulate macrophages to over produce IL-1 and TNF-alpha.

Anti-cytokine therapy in RA

• Rheumatoid arthritis (RA) is an autoimmune disease characterised by inflammation of the joints and a progressive loss of joint function.
• New therapies for RA include the use of anti-cytokine reagents to block the action of TNFalpha or IL-1beta, e.g. Etanercept is a recombinant protein consisting of a portion of a TNF receptor fused to the Fc portion of human immunoglobulin IgG to prolong its circulating half-life.

Disfunctions of cytokine receptors

Polymorphisms in the genes encoding cytokine receptors have been shown to correlate with an increased susceptibility to:

• infection;
• severe combined immune deficiency (SCID); and
• inflammatory conditions.
• Further examples are the mutations in the IFNγ receptor (IFNγR) or IL-12 receptor (IL-12R), which increase susceptibility to mycobacterial infection.

BIOM2004 W4 Lecture 4

Cells of Innate Immune Response

Dr R Furmonaviciene

• Learning Outcomes:
• Discuss the cell types involved in innate immune response
• Discuss briefly how these cells recognise antigens
• Actively participate in pre-session, during-session and post-session learning; to start using OneClass Notebook (see Blackboard)

Write your summary here:

Bite 1

Cells of Innate Immune Response:

Cell types and Functions

Learning Outcomes

To discuss the functions

of

NK cells,

phagocytes,

dendritic cells

What Key Cells Types Participate in an Immune Response?

The mechanisms of innate immunity provide the initial defense against infections. Adaptive immune responses develop later and consist of activation of lymphocytes. The kinetics of the innate and adaptive immune responses are approximations and may vary in different infections.

Innate and adaptive immunity

Cellular

Immune

response

Cellular

Humoral

Humoral

Key Cells and Proteins Involved in an Immune Response

• Innate immune response involves key cell types:
• Dendritic cells, phagocytes, NK cells, basophils, eosinophils
• Adaptive immune response involves
• B cells and T cells (lymphocytes)
• Cytokines (defensive proteins and peptides) are produced by all cells mentioned
• Antibodies are produced by B cells only

Cells of the innate immune system:

Neutrophils have multilobed nucleus, because of which these cells are also called polymorphonuclear leukocytes, and the faint cytoplasmic granules.

Phagocytose pathogens

Inflammatory cells

Phagocytes: Neutrophils, Monocytes and Macrophages

Microbes may be ingested by different membrane receptors of phagocytes; some directly bind microbes, and others bind opsonised microbes. The microbes are internalised into phagosomes, which fuse with lysosomes to form phagolysosomes, where the microbes are killed by reactive oxygen and nitrogen intermediates and proteolytic enzymes. NO, nitric oxide; ROS, reactive oxygen species.

Phagocytosis

Notatki:

Microbes may be ingested by different membrane receptors of phagocytes; some directly bind microbes, and others bind opsonized microbes.

The microbes are internalised into phagosomes, which fuse with lysosomes to form phagolysosomes, where the microbes are killed by reactive oxygen and nitrogen intermediates and proteolytic enzymes.

Phagocytosis is an active, energy-dependent process of engulfment of large particles (>0.5 μm in diameter). Microbial killing takes place in the vesicles formed by phagocytosis, and in this way, the mechanisms of killing, which could potentially injure the phagocyte, are isolated from the rest of the cell.

• NK cells recognize ligands on infected cells or cells undergoing other types of stress, and kill the host cells. In this way, NK cells eliminate reservoirs of infection as well as dysfunctional cells.
• NK cells respond to IL-12 produced by macrophages and secrete IFN-gamma, which activates the macrophages to kill phagocytosed microbes.

NK cell

functions

Role of dendritic cells in antigen capture and presentation

Notatki:

Mature dendritic cells express high levels of class II MHC molecules with bound peptides as well as co-stimulators required for T cell activation (APCs – Antigen Presenting Cells).

This process of maturation can be reproduced in vitro by culturing bone marrow-derived immature dendritic cells with cytokines (such as tumour necrosis factor and granulocyte-macrophage colony-stimulating factor) and microbial products (such as endotoxin).

Thus, by the time these cells become resident in lymph nodes, they have developed into potent APCs with the ability to activate T lymphocytes. Naive T cells that recirculate through lymph nodes encounter these APCs. T cells that are specific for the displayed peptide-MHC complexes are activated, and an immune response is initiated.

Resting (immature) dendritic cells express membrane receptors that bind microbes, such as mannose receptors. Dendritic cells use these receptors to capture and endocytose microbial antigens, and begin to process the proteins into peptides capable of binding to MHC molecules.

Dendritic cells also express Toll-like receptors that recognise microbial molecules and activate the cells to secrete cytokines and start their process of maturation.

Dendritic cells that are activated by microbes and by locally produced cytokines, such as tumor necrosis factor, lose their adhesiveness for epithelia and begin to express a chemokine receptor called CCR7 that is specific for chemokines produced in the T cell zones of lymph nodes. The chemokines attract the dendritic cells bearing microbial antigens into the T cell zones of the regional lymph nodes.

Receptors of Innate Recognition

Receptors have broad recognition (poly-specific)

Dendritic Cell Toll-like receptors (TLRs) recognize a wide variety of PAMPs

The basic steps in TLR signaling, illustrated only for TLR2 and TLR4, are applicable to all TLRs.

TLRs

https://www.frontiersin.org/articles/10.3389/fimmu.2016.00556/full

Innate and Adaptive Immunity Timeline

(Paper link – optional extra reading)

What Can Go Wrong with Cells of Innate Immune Response? Dendritic cells and Monocytes in Atherosclerosis

Immunity 2017 47, 621-634DOI: (10.1016/j.immuni.2017.09.008)

https://www.cell.com/immunity/fulltext/S1074-7613(17)30419-3

Macrophages and DCs may contribute to plaque formation

Paper link – optional extra reading

Notatki:

Regulation of Innate Immune Processes Related to Monocyte-Macrophages in Atherosclerosis

Lesional macrophages originate from bone-marrow-derived hematopoietic stem and progenitor cells (HSPCs), which give rise to circulating monocytes. In certain instances, these stem cells first populate the spleen and then undergo extramedullary hematopoiesis. Proliferation and release of HSPCs can be exacerbated by elevated cellular cholesterol and by somatic mutations leading to clonal hematopoiesis, such as those that occur in aging and myeloproliferative disease (MPD). This process can also be stimulated by stress-induced activation of the sympathetic nervous system (SNS). The major subpopulation of monocytes that contribute to atherosclerosis progression are Ly6chi monocytes, which enter lesions in response to subendothelially retained apolipoprotein-B-containing lipoproteins (LPs) and subsequent chemokine release by activated endothelial cells. After differentiation into macrophages, these myeloid cells undergo a variety of phenotypic changes under the influence of the factors listed in the figure. Those macrophages on the inflammatory end of the spectrum secrete proteins and carry out processes that promote atherosclerosis progression, whereas those on the resolution end of the spectrum promote lesion regression.

Do you remember an example of a cytokine and it’s function?

Inflammation and Immunobiology

(BIOM2004)

T CELLS

Dr Naomi Martin

HB 1.32

naomi.martin@dmu.ac.uk

• Aims: to learn more about T lymphocytes
• Learning objectives:
• Describe and discuss T cell structure and function
• Describe and discuss T cell development
• Describe and discuss T cell activation and the function of different types of T cell

LEARNING AIMS & OBJECTIVES

This defence can be NON-SPECIFIC or SPECIFIC

• This defence can be NON-SPECIFIC or SPECIFIC
• Non-specific mechanism of defence
• Does not distinguish between infective agents

THE IMMUNE SYSTEM

LO: to learn more about T lymphocytes

This defence can be NON-SPECIFIC or SPECIFIC

• This defence can be NON-SPECIFIC or SPECIFIC
• Specific mechanisms of defence
• Responds specifically to particular infective agents

THE IMMUNE SYSTEM

LO: to learn more about T lymphocytes

A small leukocyte (white blood cell) with a single round nucleus, occurring especially in the lymphatic system

• A small leukocyte (white blood cell) with a single round nucleus, occurring especially in the lymphatic system
• Role in specific immune defence
• MAIN JOB IS TO FIGHT INFECTION

LYMPHOCYTES

LO: to learn more about T lymphocytes

Cellular immunity is mediated by T cells

• Cellular immunity is mediated by T cells
• Same lineage as B cells – progenitor identical
• Depends on where it becomes immunocompetent
• T cells develop in the Thymus
• T cells do not produce antibodies

T LYMPHOCYTES

LO: Describe and discuss T cell structure and function

T cells have antigen receptors that are structurally related to antibodies

• T cells have antigen receptors that are structurally related to antibodies

T LYMPHOCYTES

LO: Describe and discuss T cell structure and function

T cells have antigen receptors that are structurally related to antibodies

• T cells have antigen receptors that are structurally related to antibodies

T LYMPHOCYTES

LO: Describe and discuss T cell structure and function

Develop in the Thymus (in the upper chest)

• Develop in the Thymus (in the upper chest)
• Each T cell possesses a unique antigen-binding molecule called the T cell receptor (TCR)

T LYMPHOCYTES

LO: Describe and discuss T cell structure and function

These antigen receptors help recognise antigens only in the form of peptides displayed on the surface of antigen-presenting cells

• These antigen receptors help recognise antigens only in the form of peptides displayed on the surface of antigen-presenting cells

T LYMPHOCYTES

LO: Describe and discuss T cell structure and function

Only recognise antigen that is bound to cell membrane proteins called major histocompatibility complex (MHC) molecules.

• Only recognise antigen that is bound to cell membrane proteins called major histocompatibility complex (MHC) molecules.

T LYMPHOCYTES

LO: Describe and discuss T cell structure and function

A number of different subsets exist – defined by surface antigens, function or cytokine production

• A number of different subsets exist – defined by surface antigens, function or cytokine production
• MHC class I (found on all nucleated cells)
• MHC class II (found on APC)
• MHC class III (found on hepatocytes, macrophages)

T LYMPHOCYTES

LO: Describe and discuss T cell structure and function

T CELL DEVELOPMENT

LO: Describe and discuss T cell development

Thymus section showing lobular organization:

This section shows the two main areas of the thymus lobule – an outer cortex of immature cells (C) and an inner medulla of more mature cells (M).

T CELL DEVELOPMENT

LO: Describe and discuss T cell development

Selection of the T cell repertoire occurs in the thymus

• Selection of the T cell repertoire occurs in the thymus
• Recognition
• CENTRAL TOLERANCE
• Mechanism whereby the immune system is impaired in its response to respond to self-antigens
• Many T cells are eliminated
• Selection mechanisms operate to shape the T-cell repertoire

T CELL MATURATION

LO: Describe and discuss T cell development

Positive selection

Positive selection

only T cells with a receptor that bind with affinity to self-peptide MHC survive – others are eliminated by apoptosis – ENSURES MHC RECOGNITION

Negative selection

T cells with a receptor that bind with high avidity to self-antigen or self-antigen presented by MHC undergo apoptosis – ENSURES SELF-TOLERANCE

T CELL MATURATION

LO: Describe and discuss T cell development

T cell precursor goes from bone marrow to the thymus

• T cell precursor goes from bone marrow to the thymus
• In the cortex of the thymus, positive selection occurs
• This is a check to see if the T cells interact with MHC
• Cells that are able to interact with MHC receive survival signals
• Those that do not interact do not receive a survival signal and die by apoptosis

T CELL MATURATION

LO: Describe and discuss T cell development

Those T cells which interact with MHC class I are differentiated into CD8 or cytotoxic T cells

• Those T cells which interact with MHC class I are differentiated into CD8 or cytotoxic T cells
• T cells which interact with MHC class II are differentiated into CD4 or helper T cells

T CELL MATURATION

LO: Describe and discuss T cell development

Differentiated T cells now go to the medulla of the thymus

• Differentiated T cells now go to the medulla of the thymus
• Negative selection occurs in the medulla
• This checks how well the T cells bind with self MHC peptides

T CELL MATURATION

LO: Describe and discuss T cell development

M

If this interaction is too strong, the cell will not receive survival signals and will undergo apoptosis

• If this interaction is too strong, the cell will not receive survival signals and will undergo apoptosis
• Without this negative selection, self-reactive T cells capable of inducing autoimmune diseases are produced
• Mature T cells are then released to the lymph nodes

T CELL MATURATION

LO: Describe and discuss T cell development

After passing through these checks of positive and negative selection, the T cells are released into the lymph nodes and are now mature naïve T cells

• After passing through these checks of positive and negative selection, the T cells are released into the lymph nodes and are now mature naïve T cells

T CELL MATURATION

LO: Describe and discuss T cell development

On recognition of peptide-MHC by their TCR, a naïve T cell (Th0) becomes activated  differentiate  proliferate

• On recognition of peptide-MHC by their TCR, a naïve T cell (Th0) becomes activated  differentiate  proliferate
• The activation required recognition of antigens displayed on APCs, co-stimulators and cytokines produced by the APCs and the T cells themselves
• These signals tell the cells what to do

LO: Describe and discuss T cell activation and the function of different types of T cell

T CELL ACTIVATION

• They become differentiated into distinct populations

LO: Describe and discuss T cell activation and the function of different types of T cell

T CELL ACTIVATION

• Clustering of surface receptors such as TCR, CD4, CD28 and CD45 results in activation of intracellular signal transducers

Three signals are necessary for full T cell activation

• Three signals are necessary for full T cell activation
• SIGNAL 1: generated by the interaction of MHC-peptide with the TCR
• The interaction between the TCR and ag/MHC alone is not enough to sustain the contact between the T cells and APC

LO: Describe and discuss T cell activation and the function of different types of T cell

T CELL ACTIVATION

• SIGNAL 2: generated by the interaction of CD28 on the T cell and members of the B7 family on the APC; this is called the co-stimulatory signal
• Integrins and their receptors on the T cell and APC strengthen this interaction so that the TCR and CD28 can receive prolonged and sustained signals

LO: Describe and discuss T cell activation and the function of different types of T cell

T CELL ACTIVATION

SIGNAL 3: cytokine stimulation

• SIGNAL 3: cytokine stimulation
• Signals through the integrins also enhance T cell activation

LO: Describe and discuss T cell activation and the function of different types of T cell

T CELL ACTIVATION

HELPER TH (CD4+) cells secrete cytokines which stimulate the proliferation and differentiation of T cells, B cells, macrophages & other leukocytes

• HELPER TH (CD4+) cells secrete cytokines which stimulate the proliferation and differentiation of T cells, B cells, macrophages & other leukocytes
• Helper T cells release molecules which warn the immune system of the presence of a danger

LO: Describe and discuss T cell activation and the function of different types of T cell

TYPES OF T CELLS – HELPER TH

In 1986, Mosmann and colleagues observed that individual clones of helper T cells could be separated into two classes depending upon the specific cytokines the cells secrete in response to antigenic stimulation

• In 1986, Mosmann and colleagues observed that individual clones of helper T cells could be separated into two classes depending upon the specific cytokines the cells secrete in response to antigenic stimulation

LO: Describe and discuss T cell activation and the function of different types of T cell

TYPES OF T CELLS – HELPER TH

T.R. Mosmann, et al., “Two types of murine helper T cell clone: I. Definition according to profiles of lymphokine activities and secreted proteins,” Journal of Immunology, 136:2348-57, 1986.

The two helper T cell classes also differ by the type of immune response they produce:

• The two helper T cell classes also differ by the type of immune response they produce:
• Th1 cells primarily produce interferon (IFN)-ɣ and interleukin (IL)-2
• Th1 cells – generate responses against intracellular parasites such as bacteria and viruses, cell-mediated responses

LO: Describe and discuss T cell activation and the function of different types of T cell

TYPES OF T CELLS – HELPER TH

Th2 cells produce IL-4, IL-5, IL-6, IL-10, and IL-13

• Th2 cells produce IL-4, IL-5, IL-6, IL-10, and IL-13
• Th2 cells – produce immune responses against helminths and other extracellular parasites, humoral response e.g. IgE production

LO: Describe and discuss T cell activation and the function of different types of T cell

TYPES OF T CELLS – HELPER TH

Interestingly, the cytokines produced by each Th subset tend to both stimulate production of that Th subset and inhibit development of the other Th subset.

• Interestingly, the cytokines produced by each Th subset tend to both stimulate production of that Th subset and inhibit development of the other Th subset.
• IFN-ɣ produced by Th1 cells has the dual effect of both stimulating Th1 development and inhibiting Th2 development.
• Th2-secreted IL-10 has the opposite effect.

LO: Describe and discuss T cell activation and the function of different types of T cell

TYPES OF T CELLS – HELPER TH

CYTOTOXIC Tc (CD8+) cells kill cells that produce foreign antigens

• CYTOTOXIC Tc (CD8+) cells kill cells that produce foreign antigens
• Attach themselves to other cells in the body, if this cell is diseased or pathogenic, the T cell will either
• Force the cell to undergo apoptosis
• Secrete enzymes which will kill the cell

LO: Describe and discuss T cell activation and the function of different types of T cell

TYPES OF T CELLS – CYTOTOXIC TC

Responsible for the direct killing of infected, damaged, and dysfunctional cells, including tumour cells

• Responsible for the direct killing of infected, damaged, and dysfunctional cells, including tumour cells
• Once inside cells, these pathogens are not accessible to antibodies and can be eliminated only by the destruction or modification of the infected cells on which they depend
• Powerful and accurately targeted

LO: Describe and discuss T cell activation and the function of different types of T cell

TYPES OF T CELLS – CYTOTOXIC TC

Cytotoxic T cells kill their targets by programming them to undergo apoptosis (nuclear fragmentation)

• Cytotoxic T cells kill their targets by programming them to undergo apoptosis (nuclear fragmentation)
• Recognise
• Peptide fragments
• MHC I
• Cytotoxins

LO: Describe and discuss T cell activation and the function of different types of T cell

TYPES OF T CELLS – CYTOTOXIC TC

https://highered.mheducation.com/sites/0072495855/student_view0/chapter24/animation__cytotoxic_t-cell_activity_against_target_cells__quiz_1_.html

LO: Describe and discuss T cell activation and the function of different types of T cell

TYPES OF T CELLS – CYTOTOXIC TC

• Calcium-dependent release of specialized lytic granules
• e.g. perforin – forms transmembrane pores
• e.g. granzymes – act as digestive enzymes

CD4+ helper T cells bind to MHC class II molecules

• CD4+ helper T cells bind to MHC class II molecules
• Found on mononuclear phagocytes, B cells, dendritic cells
• CD8+ cytotoxic T cells bind to MHC class I molecules
• Found on all nucleated cells (including cells expressing MHC II)

T CELL RECEPTOR

LO: Describe and discuss T cell activation and the function of different types of T cell

Consists of 2 polypeptides α and β, or γ and δ

• Consists of 2 polypeptides α and β, or γ and δ
• Each polypeptide chain has 2 regions (1 variable, 1 constant)
• Each T cell has a unique TCR on its surface
• Hundreds of millions
• Similar to immunoglobulin chains
• Variable and constant regions = diversity

T CELL RECEPTOR

LO: Describe and discuss T cell activation and the function of different types of T cell

α β

• α β
• Recognise antigens BUT only in conjunction with MHC proteins (immunoglobulins recognise free antigens)
• The complementary determining regions form the binding site for antigen/MHC molecule

T CELL RECEPTOR

LO: Describe and discuss T cell activation and the function of different types of T cell

Small subset of T cells, about 1-5% total T cell population

• Small subset of T cells, about 1-5% total T cell population
• TCR glycoproteins ɣδ, instead of αβ
• Enriched (>50 % of the T cell population) in epithelial cell-rich compartments like skin, the digestive tract, and reproductive organ mucosa

LO: Describe and discuss T cell activation and the function of different types of T cell

TYPES OF T CELLS – GAMMA DELTA Tɣδ

Role in immunoregulation & immunosurveillance

• Role in immunoregulation & immunosurveillance
• Cytotoxic
• Kill infected & activated cells
• Engage death receptors (FAS)
• Release cytotoxic effector molecules (Perforin)
• Undergo functional programming in the thymus
• Sense cellular stress
• Contribute to different stages of the inflammatory response
• Major role in RESOLUTION of the immune response

LO: Describe and discuss T cell activation and the function of different types of T cell

TYPES OF T CELLS – GAMMA DELTA Tɣδ

Not MHC restricted

• Not MHC restricted
• Recognise whole proteins rather than peptides
• Role in the resolution of the immune response
• Functions of γδ T cells differ according to = functional plasticity
• their tissue distribution
• the structure of their antigen receptors
• how and what stage of the immune response they have become activated

TYPES OF T CELLS – GAMMA DELTA Tɣδ

• Aims: to learn more about T lymphocytes
• Learning objectives:
• Describe and discuss T cell structure and function
• Describe and discuss T cell development
• Describe and discuss T cell activation and the function of different types of T cell

LEARNING AIMS & OBJECTIVES

Adaptive Immunity: B Cells

BIOM2004

Week 6

Adaptive Immunity: B Cells How B Cells Contribute to an Immune Response? Learning aims: How do B cells get activated? How different antibody classes protect us from pathogens?

A. Light micrograph of a plasma cell in tissue. B. Electron micrograph of a plasma cell. (Courtesy of Dr. Noel Weidner, Department of Pathology, University of California, San Diego, California.)

Morphology of Activated B Cells

Activated B lymphocytes become plasma cells or activated B cells, secreting immunoglobulins (or antibodies)

The activation of B cells is initiated by specific recognition of antigens by the surface Ig receptors of the cells. Antigens stimulate the proliferation and differentiation of the specific B cell clone. Depending on the antigen, different classes of antibodies can be produced.

B Cell Clonal Expansion

Changes in Antibody Structure during B Cell Activation

In the course of immune response, depending on the signals, coming to B cells, antibody structures may change which will result in stronger binding or secretion of different antibody class.

Antibody Structure and Function

IgG molecule

Antibody model by Mike Clark

https://www.csap.cam.ac.uk/network/mike-clark/

Antibodies have 2 functions

Function 1:

To bind specifically to pathogen/antigen – mediated via the variable region (V region). Thereby each antibody recognises a unique antigen (Ag) to give a total repertoire large enough to recognise almost anything.

Antigen binding

• This model of lysozyme bound to an antibody molecule. The heavy chains of the antibody are colored red, the light chains are yellow, and the antigen is colored blue.

Antigen Binding

Cellular Receptor Binding

Function 2:

To recruit other cells and molecules of the immune system – feature of the constant region (C region) of the Ab – 5 main forms of C region – one for each Ab ‘type’. However, for membrane bound Ab the C region is inserted into the membrane – once V region recognises Ag the C region transmits a signal that activates the B cell.

Biological activity

Protective Functions of Antibodies

Receptors for IgG have either two or three extracellular immunoglobulin domains.

Motifs (ITAM, ITIM) on the intracellular segments or on associated polypeptides are targets for tyrosine kinases involved in initiating intracellular signaling pathways.

Fc receptors

Immunoglobulin Structure

Heavy chain

Light chain

Immunoglobulin G (IgG)

Molecular weight approximately 150 kilodalton (kDa)

composed of 2 heavy chains of 50kDa each and 2 light chains of 25kDa each

heavy chains linked by disulphide bonds and each heavy chain linked to light chain by disulphide bond

in any given antibody the 2 heavy chains and the 2 light chains are identical – so each antibody has 2 identical antibody binding regions

IgG molecules are cleaved by the enzymes papain (A) and pepsin (B) at the sites indicated by arrows. Papain digestion allows separation of two antigen-binding regions (the Fab fragments) from the portion of the IgG molecule that binds to complement and Fc receptors (the Fc fragment). Pepsin generates a single bivalent antigen-binding fragment, F(ab’)2.

Proteolytic fragments of an IgG molecule

The 5 classes of immunoglobulins are distinguished by the Constant region of their heavy chains

Class	Heavy chain	Subclasses	Light Chain
IgG	g	g1, g2, g3, g4	k or l
IgM	m	None	k or l
IgA	a	a1, a2	k or l
IgE	e	None	k or l
IgD	d	None	k or l

Minor differences in the amino acid sequences of the a and g heavy chains leads to categorisation of subclasses

Five classes – G, M, A, E, D

Immuno-globulin	IgG	IgM	IgA	IgE	IgD
Normal Levels (mg/dl)	620 – 1400	45 – 250	80 – 350	0.002 – 0.2	0.3 – 3.0

IgG: Most abundant class in serum (about 80%) – IgG1 > IgG2 > IgG3 > IgG4.

IgG1 and IgG3 bind with high affinity to Fc receptors on phagocytic cells for opsonisation (IgG 4 intermediate and IgG 2 low).

IgG3 is the most effective complement activator (then IgG1; IgG2 less efficient and IgG4 can’t).

IgG1, IgG3 and IgG4 readily cross the placenta and have an important role in protecting the fetus (passive immunity).

• A model of IgG1
• IgG3
• IgM H chains have five domains with disulfide bonds cross-linking adjacent Ch3 and Ch4 domains.
• IgA. The J chain is required to join the two subunits.
• This diagram of IgD shows the domain structure and a characteristically large number of oligosaccharide units.
• IgE.

Different Structures of Different Antibody Classes

Immunoglobulin M (IgM)

• 5% to 10% of total serum Ig.
• Monomeric IgM is membrane bound on B cells.
• Plasma cells secrete pentameric IgM (5 monomers held together by a J (joining) chain.
• IgM is the first class produced in a primary response to antigen

Y

Y

Y

Y

Y

Y

Monomeric

Pentameric

(1) In free solution, deer IgM adopts the characteristic star-shaped configuration.

(2) IgM antibody (arrow) in ‘crab-like’ configuration with partly visible central ring structure bound to a poliovirus virion.

IgA

Only 10% to 15% of total serum Ig.

BUT predominant class in external secretions (breast milk, saliva, tears and mucus in bronchial, genitourinary and digestive tracts).

Daily production of IgA is greater than for any other class.

Secretory IgA in secretions – dimer of tetramer with a J chain and secretory component.

Binding to bacterial and viral surface antigens prevents attachment of pathogens to mucosal cells.

Y

Y

Y

Y

Mast Cell

Fc Receptor specific for IgE

Granule

IgE

Allergen

Immunoglobulin E

IgE serum levels are elevated in people with parasite infection or allergy (eczema, hay fever, asthma, anaphylactic shock).

IgE binds to Fc receptors on blood basophils and tissue mast cells – cross-linking by allergen induces release of granule contents (pharmacologically active mediators).

Immunoglobulin D

• About 0.2% of total serum immunoglobulin.
• Together with IgM is the major membrane bound Ig expressed by mature B cells.
• No biological effector function has been described for IgD.

Antibodies can be designed and used for diagnostics and therapy

Search research papers to find an example of an antibody used in diagnostic test – optional task for your independent extra reading

Immunoglobulins (Ig) or antibodies are:

• produced by B cells
• become secreted – circulating antibodies
• when membrane bound act as B cell surface receptor (BCR)
• all activated B cells produce a vast array of Ig/Ab with a variety of antigen specificities
• BUT each B cell produces Ig/Ab with a single specificity (produced Abs bind one antigen)

Summarising Comments

Please use module Discussion Board for your questions or message me on MS Teams 

BIOM2004 W1 Lecture 1

Introduction to the Inflammation and Immunobiology Module

Dr R Furmonaviciene

• Learning Outcomes:
• To clarify all doubts about the learning goals, study themes and assessments; to be able to tell your colleagues this information
• To discuss your ideas about how immune system is activated
• To actively participate in pre-session, during-session and post-session learning

BIOM2004 W1 Lecture 1

• Learning themes and sessions
• Finding your way online
• Assessments
• Communication
• All can be found on Blackboard site of the module,

BIOM2004 Module Content

How many credits?

How many lecturers?

How many assessments?

When is the first assessment due?

How many credits?

How many credits?

How many lecturers?

How many lecturers?

Find the answer in ‘Staff Contacts’

On Blackboard

How many assessments?

How many assessments?

Look for the answer in the module Template

(Information about the module site on Blackboard)

Quiz (MCQs)

Exam

When is the first assessment due?

When is the first assessment due?

We have formative (unmarked) assessments to help you to prepare for the summative ones (marked)

Formative Quiz (MCQ) Week 4 (some examples of MCQs)

Summative Quiz (MCQ) Week 29

We will give you all the details closer to the dates – please attend all sessions

Study Materials for Lecture 1:

• You Tube video about P Matzinger (available on Blackbaord) (compulsory)
• Conversation with P Matzinger text (available on Blackboard)

• Which answers are right?

Quick Quiz about Polly Matzinger after you examined the pre-session material about her 

Legends of allergy/immunology: Polly Matzinger

Allergy, Volume: 75, Issue: 8, Pages: 2136-2138, First published: 21 January 2020, DOI: (10.1111/all.14191)

Notatki:

Danger Model. Professional antigen‐presenting cells (Macrophages or DC) are activated to stimulate T cells by endogenous cellular alarm signals released from distressed or damaged cells

IF THIS IMAGE HAS BEEN PROVIDED BY OR IS OWNED BY A THIRD PARTY, AS INDICATED IN THE CAPTION LINE, THEN FURTHER PERMISSION MAY BE NEEDED BEFORE ANY FURTHER USE. PLEASE CONTACT WILEY’S PERMISSIONS DEPARTMENT ON PERMISSIONS@WILEY.COM OR USE THE RIGHTSLINK SERVICE BY CLICKING ON THE ‘REQUEST PERMISSIONS’ LINK ACCOMPANYING THIS ARTICLE. WILEY OR AUTHOR OWNED IMAGES MAY BE USED FOR NON-COMMERCIAL PURPOSES, SUBJECT TO PROPER CITATION OF THE ARTICLE, AUTHOR, AND PUBLISHER.

How immune system gets activated?

Immune system is activated by molecular patterns signaling danger, e.g.:

bits of RNA or DNA,

hydrophobic molecules,

proteolytic enzymes

What parts of immune system react to danger?

P Matzinger mentions lymph nodes,

B, T, dendritic cells,

MHC molecules as being involved in an immune response

Give some examples of danger signals and non-dangerous events (these will not triger immune response)

Danger signals: e.g.: allergens which are harmful proteins or they may mimic danger- signalling molecules; microbial, viral proteins

Non-dangerous events: development of the fetus, apoptosis during development of the fingers, where unnecessary cells disappear by apoptosis

• Structure?
• Function?
• Activation?

Suggest your best definition of the ‘Immune System’…

Immune system is composed of organs, cells and molecules

Immune system is activated by danger signals

Organs, cells and molecules work together as a defensive network

Final Task:

Read the following paper

https://www-proquest-com.proxy.library.dmu.ac.uk/docview/2434147450?OpenUrlRefId=info:xri/sid:summon&accountid=10472

Damage-associated molecular patterns in trauma

Borna, Relja; Land Walter Gottlieb.European Journal of Trauma and Emergency Surgery; Heidelberg Vol. 46, Iss. 4,  (Aug 2020): 751-775. DOI:10.1007/s00068-019-01235-w

and answer the question below:

How Can Danger-Associated Molecular Patterns (DAMPs) promote tissue healing?

Study Materials for Lecture 2:

Read the following paper

https://www-proquest-com.proxy.library.dmu.ac.uk/docview/2434147450?OpenUrlRefId=info:xri/sid:summon&accountid=10472

Damage-associated molecular patterns in trauma

Borna, Relja; Land Walter Gottlieb.European Journal of Trauma and Emergency Surgery; Heidelberg Vol. 46, Iss. 4,  (Aug 2020): 751-775. DOI:10.1007/s00068-019-01235-w

and answer the question below:

How Can Danger-Associated Molecular Patterns (DAMPs) promote tissue healing?

Dr Umakhanth Venkatraman GIRIJA

umakhanth.venkatramangirija@dmu.ac.uk

Complement

in the

Immune system

C

C

C

C

BIOM2004

Inflammation & Immunobiology

Learning Objectives	Learning Outcomes
1. Complement components & activation	What is complement pathway?Which cells produce complement proteins?What are the different types of pathways ?What are the different target recognition mechanisms?How do the pathways get activated?What are the various effector mechanisms and the fate of the target cells?
2. Regulation of Complement	What is Complement Regulation? Why is regulation of complement important?What are the types of complement regulators?Learn with examples

Targets Pathogens

• Bacteria
• Virus
• Fungi
• Protozoa

Targets Damaged Self-Cells

• Physical damage
• Chemical damage
• Neoplasm

Importance

Complement, part of innate immune system, is a network of ~40 different proteins. It can recognise (bind) to and eliminate a wide range of target cells and also bridge adaptive immunity

How does Complement work

Complement, part of innate immune system,

is a network of ~40 different proteins.

They (have to) work via defined pathways to carefully eliminate pathogens and not human cells

The 40 different proteins have to work in an organised manner

What are Complement Pathways?

• Biochemical pathways that are part of innate immune system
• They ‘recognise’ pathogens or target cells via different ways
• They ‘function’ via enzymatic cascade and ‘eliminate’ pathogens or target cells via various mechanisms

CLASSICAL

Pathway

It is based on recognition, complement pathways are classified in to three different types

LECTIN

pathway

ALTERNATIVE

Pathway

Where are Complement Proteins Produced?

LIVER

MACROPHAGES

• Majority of the complement proteins are produced by liver and macrophages
• They are also produced by endothelial/epithelial cells, cells of immune system such as dendritic cells, T- & B- lymphocytes, mast cells and Natural killer cells

Target recognition & activation

Enzymatic cascade

Target elimination

COMPLEMENT

Antigen-Antibody

Pathogen

C1q

C1r, C1s proteases

C1q, a multimeric protein in complex with

C1r & C1s proteases (C1-complex)

binds antigen-antibody complex

Target recognition & activation

Enzymatic cascade

Target elimination

Antibody ‘dependent’ pathway

C1q upon binding to a target undergoes a conformational change to activate the associated serine proteases C1r and C1s and this triggers an enzymatic cascade and the classical pathway

1

CLASSICAL

Pathway

Pathogen

Glycans are chains of sugars (also called as oligosaccharides) that decorate cell surface of both pathogens and human cells – but what is the key difference between them?

Human cell

Mannose sugar at terminal position in microbial glycan

Mannose sugar NOT at terminal position in human glycan

MBL

MBL

As a result, pathogen can be recognized by a protein called human mannose-binding lectin (MBL) via recognition of terminal mannose

Human cell cannot be recognized by human mannose-binding lectin (MBL)

Pathogen

Antibody ‘independent’ pathway

Lectins along with the partner proteases directly bind to carbohydrate structures on microbial or target cell surfaces; undergo a conformational change to trigger the enzymatic cascade and pathway

2

Mannose present at terminal position

MBL

Mannose-Binding Lectin (MBL) in complex with MBL-associated serine proteases (MASPs) bind pathogens directly via the terminal mannose sugars on the surface of pathogens

MASPs

Target recognition & activation

Enzymatic cascade

Target elimination

LECTIN

pathway

Pathogen

H2O

C3

Spontaneous hydrolysis of C3 protein

generates C3b that binds to

–OH or –NH2 groups on pathogens

C3 is an abundant complement protein in the serum (~ 1.2 mg/ml)

There is constant hydrolysis of C3 in the serum, which in the presence of proteins factor B & properdin generate C3b and trigger the alternative pathway.

3

Target recognition & activation

Enzymatic cascade

Target elimination

C3b

ALTERNATIVE

Pathway

Antibody-Antigen

Pathogen

C1q

C1r, C1s proteases

MBL

Complement recognizes target cells via multiple ways and accordingly, the pathways are classified; Fill the boxes

1

2

3

MASPs

H2O

C3

C3b

Antibody-Antigen

Pathogen

C1q

C1r, C1s proteases

MBL

Complement recognizes target cells via multiple ways and accordingly, the pathways are classified

1

2

3

MASPs

H2O

C3

C3b

ALTERNATIVE

Pathway

CLASSICAL

Pathway

LECTIN

pathway

Target recognition & activation

Enzymatic cascade

Target elimination

C3b

Pathogen

2. Coats “Eat me signal”

Phagocyte

1. “Punches holes” and destroys

Pathogen

Pathogen

3. “Calls for help” from other cells

C3a

C5a

C3a

C5a

Target recognition & activation

Enzymatic cascade

Target elimination

1. “Punches holes” and destroys

Pathogen

Target recognition & activation

Enzymatic cascade

Target elimination

CLASSICAL pathway as an example

Explore more

Cytosol

Plasma membrane

Antigens

C4

Antibody

C2

C1

C4b

C4a

Released into blood/extracellular fluid (call for help)

C2b

C2a

C3 convertase

C3

C3b

C3a

C5

C5a

C5b

C6

C7

C8

Cell leakage and death

Poly C9

Membrane Attack Complex (MAC) (C5b-C9)

The Classical Pathway Cascade

Pathogen

CLASSICAL

ALTERNATIVE

LECTIN

The three pathways recognise targets differently, but converge at C3b and follow the same route to eliminate pathogens e.g. via cell lysis

Complement killing

E. coli

Lysed E. coli

(Electron microscopy image; Kuby, Immunology, 2003)

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3820029/

SELF-DIRECTED LEARNING # 1

W7 Complement_DR GIRIJA

• There are five major classes of antibodies. Which ones activate classical pathway of activation?
• An antibody has Fc and Fab regions. Which of this region binds to C1q?

SELF-DIRECTED LEARNING # 2

W7 Complement_DR GIRIJA

You have now learnt that lectin pathway of complement is activated by mannose binding lectin (MBL) and MBL-associated serine proteases (MASPs). MBL recognises mannose on the target cell surface.

• Are there any other components/proteins other than MBL that activate lectin pathway? Learn some examples along with what ligands they can recognise

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7408476/

C3b

Pathogen

2. Coats “Eat me signal”

Phagocyte

Target recognition & activation

Enzymatic cascade

Target elimination

Pathogen

Macrophages have C3b receptors and bind to C3b (complement fragment) coated on target cells during the enzymatic cascade process

What is the “Eat me” signal ?

C3b

Pathogen

C3b

C3b

Macrophage

C3b receptors

CLASSICAL

LECTIN

ALTERNATIVE

C3b

Coated by any or all of the three pathways

Formation of Phagosome

Fusion of Phagosome and lysosome to form phagolysosome

Macrophage engulfs C3b coated pathogen

Lysosomal enzymes degrade the pathogen-complement complex

Degraded fragments released as debris from macrophage

Complement C3b mediated phagocytosis is very effective in clearing pathogens

“Eat me signal”

Pathogen

3. “Call for help” from other cells

C3a

C5a

C3a

C5a

Target recognition & activation

Enzymatic cascade

Target elimination

Signals (phosphorylation)

C3b

C4b

C2a

C4b

C3d

C2a

CD19

CD21

B-cell

C3d receptor

B-cell activation and proliferation

Antibody production and Memory cell formation

By stimulating antibody production, Complement bridges innate and adaptive immune system. This is vital for mounting a strong and long lasting immune response towards invading pathogens.

Complement stimulates antibody production

Macrophage

Neutrophil

Basophil

Eosinophil

Mast cell

C3a

C5a

C3a

C5a

Call for help from other immune cells

Complement activation products such as C3a & C5a act as anaphylatoxins and interact with many other cells of immune system and can cause inflammation

Chemotaxis

Phagocytosis

Cytokine production

Degranulation

Oxidative burst

Learning Objectives	Learning Outcomes
1. Complement components & activation	What is complement pathway?Which cells produce complement proteins?What are the different types of pathways ?What are the different target recognition mechanisms?How do the pathways get activated?What are the various effector mechanisms and the fate of the target cells?
2. Regulation of Complement	What is Complement Regulation? Why is regulation of complement important?What are the types of complement regulators?Learn with examples

Complement

SELF

(Do NOT attack)

NON SELF

(Attack)

ALTERED SELF

(Attack)

What are Regulators of Complement Activation (RCA)?

Regulatory proteins bind to various complement components and inhibit their “inappropriate activation” by

• destabilizing activation complexes
• mediating specific proteolysis of activation-derived fragments

Inappropriate complement activation = (a) unnecessary pathway initiation and activation in the serum or extracellular fluid and (b) activation on self-cells

DAF

MAC-IP

MCP

Human cell

• DAF = Decay Accelerating Factor (dissociates C3 convertase)
• MAC-IP = Membrane Attack Complex – Inhibitory Protein (inhibits polymerization of C9)
• MCP = Membrane Cofactor of Proteolysis (degrades C4b and C3b)

• Pathogens, in general, do not have complement regulators.
• Exception: They may adapt to innate immune system and acquire them

Membrane bound Regulators of Complement Activation prevent self-attack in a range of ways

Soluble Regulators in the plasma or extracellular fluid are recruited on host cell surface to prevent complement self-attack

C1 INH

Factor

I

Factor

H

Protein

S

SIALIC ACID (N-acetyl Neuraminic acid derivatives) and GLYCOSAMINOGLYCANS of Human Cell facilitate binding of regulators from blood

• Difference in the cell surface carbohydrate composition of host versus microbial cells favours the host.
• Pathogens generally lack or have significantly lower levels of sialic acid and hence cannot recruit complement regulators, thus susceptible to complement attack

Complement Lectures – Summary

Complement network provides front line immune defence against pathogens, altered self cells and allergens.

Complement can be initiated by Classical, Lectin and the Alternative pathways. They eliminate the targets cells by multiple mechanisms: Lysis, phagocytosis and cell signalling.

Human Complement regulation is very important to prevent self-damage. There are a number of membrane-bound and soluble complement regulators that prevent complement self-damage. Pathogens normally cannot use these human regulatory mechanisms, however there are exceptions.

http://www.annualreviews.org/doi/abs/10.1146/annurev-immunol-032713-120154

Complement general review

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4543182/pdf/kjped-58-239.pdf

Complement Regulation

Recommended books and journal articles:

Further reading

• Abul K Abbas, Andrew H Lichtman and Shiv Pillai. Cellular and molecular Immunology, Elsevier, 2014, 8th edition
• Owen, Punt and Stranford. Kuby Immunology; Palgrave Macmillian. 2015. 7th edition.
• Peter J. Delves, Seamus J. Martin, Dennis R. Burton and Ivan M. Roitt. ROITT’S ESSENTIAL IMMUNOLOGY; 2011, 12th edition

Books

Dr Umakhanth Venkatraman GIRIJA

umakhanth.venkatramangirija@dmu.ac.uk

BIOM2004

Inflammation & Immunobiology

Major Histo Compatibility (MHC)

or Human Leukocyte Antigen (HLA)

Learning Objectives	Learning Outcomes
1. Types, Structure and functions	What is MHC?What are the different types of MHC?What are the structural features of MHC proteins?What is the function of MHC and how is it important?What are polygenic and polymorphic properties of MHC? How are they important?
2. Antigen processing and presentation	Antigen processing and presentation by MHC-IExpression of MHC-IMolecular processing and presentation of antigenic peptidesAntigen processing and presentation by MHC-IIExpression of MHC-IIMolecular processing and presentation of antigenic peptides

MHC

Organ Transplantation

is the process of taking organs from one individual to another individual

Genetically identical individuals

Genetically different individuals

Inherited Genes must be involved in the process of

transplant rejection

Notatki:

Transplantation of organs, cells and tissues between genetically identical individuals are accepted, while that of between genetically different individuals were rejected. This showed that “inherited genes” must be involved in the process of rejection.

Major Histo Compatibility (MHC)

Tissue

Suitability / matching

Inherited Genes must be involved in the process of

transplant rejection

MHC complex

is a collection of genes arrayed within a long stretch of DNA on chromosome 6 in humans

MHC is called as Human Leukocyte Antigen (HLA) complex

MHC = HLA

Notatki:

The human MHC was discovered by searching for cell surface molecules in one individual that would be recognized as foreign by another individual. It was discovered that individuals who had received multiple blood transfusions and patients who had received kidney transplants contained antibodies that recognised cells from the blood or kidney donors. The proteins recognized by these antibodies were called human leukocyte antigen (HLA).

Long arm

Short arm

Chromosome 6

MHC Class II

MHC Class I

• Class I and II have common structural features
• Both have roles in antigen presentation

Class III

• Class III include complement proteins and cytokines
• Critical to immune function

MHC is of three types: Class I, II and III

2-micro globulin

Transmembrane segment

Cytoplasmic tail

1

2

3

Membrane-proximal domains (Ig-G like)

Membrane-

distal domains

1

2

1

2

(Peptide)-binding cleft

MHC Class I

MHC Class II

Notatki:

MHC class I: Composed of a polymorphic αlpha-chain (made up of three domains alpha-1,2 and 3) that are non-covalently attached to a non polymorphic Beta2-microglobulin.

MHC class II: composed of a polymorphic alpha-chain (made up of two domains alpha-1 and -2) non-covalently attached to a polymorphic beta chain (made p of two domains beta -1 and -2). The peptide binding groove is marked with arrows i.e. this is the region/cleft to which the peptides to be presented (displayed) will bind.

• Ends of peptide binding cleft is CLOSED
• Can accommodate only shorter peptides: 8-11 amino acids

• Ends of peptide binding cleft is OPEN
• Can accommodate longer peptides: 10-30 amino acids

MHC class I

MHC class II

Arrows indicate closed cleft (MHC-I) and open cleft (MHC-II);

Circles drawn to show the peptides which are reddish orange in colour

MHC presents both “SELF” and “NON-SELF” peptides

MHC displaying

“FOREIGN” peptides

• To signal immune cells for elimination of pathogens

MHC displaying “SELF” peptides

• To show the cell is healthy
• To maintain tolerance to self-proteins

Pathogen

Human cell

DP

DQ

DR

B

A

C





1







Polygenic

• Multiple MHC genes code for same function i.e. display peptides
• Each MHC molecule can bind many peptides

DP

DQ

DR

B

A

C





1







DP

DQ

DR

B

A

C





1







Polymorphic

• MHC genes are the most polymorphic genes in mammalian genome
• As a result, MHC proteins are variable in individuals
• >5000 MHC alleles have been estimated so far

DP

DQ

DR

B

A

C





1







MHC

Polymorphic

Polygenic

High degree of variability in the population

Fight range of microbial infections

MHC – Interesting Research Facts

Cheetahs have low MHC diversity

MHC – Interesting Research Facts

• MHC genes are known to be involved in mate choice in a number of species (e.g. in fish, birds, mammals)
• The more MHC variation seems to be preference for pairing
• Outcome – species diversity

Learning Objectives	Learning Outcomes
1. Types, Structure and functions	What is MHC? How was it discovered ?What are the different types of MHC?What are the structural features of MHC proteins?What is the function of MHC and how is it important?What are polygenic and polymorphic properties of MHC? How are they important?
2. Antigen processing and presentation	Antigen processing and presentation by MHC-IExpression of MHC-IMolecular processing and presentation of antigenic peptidesAntigen processing and presentation by MHC-IIExpression of MHC-IIMolecular processing and presentation of antigenic peptides

MHC

MHC class I

MHC Class I expression is found throughout the body

• ALMOST ALL NUCLEATED CELLS express MHC Class I
• Constitutive expression

• Red Blood Cells (RBCs) are non-nucleated and do not express MHC

• Lymphocytes express highest levels of MHC Class I
• 5 X 105 MHC Class I molecules per lymphocyte
• Fibroblasts, muscle cells, liver cells and some neural cells express very low levels of MHC Class I

MHC-I

Intracellular human proteins

(Normal, Cancer)

Short Peptides

PROTEASOME

(Proteasomes are multiprotein enzyme complexes and are involved in Proteolytic degradation of proteins)

Viral infections

(always intracellular)

viral proteins synthesized intra-cellularly in the host (human)

(Chlamydia, Mycobacterium, Neisseria, Salmonella)

Some bacterial infections are also intracellular

MHC-I

How peptides are formed ?

(Endogenous pathway)

Notatki:

In the MHC class I pathway, protein antigens in the cytosol (self, intracellular bacteria or viruses) are processed by proteasomes and the generated peptides are transported into the endoplasmic reticulum (ER). Proteasomes are large multiprotein enzyme complexes with a broad range of proteolytic activity. They are found in the cytoplasm and nuclei of most cells. Its structure appears like a cylinder. It performs essential function in cells by degrading damaged and misfolded proteins. Proteasomes have been adapted to process foreign proteins so that they offer a specialized role in antigen presentation.

Transporter associated with Antigen Processing (TAP)

Endoplasmic

Reticulum

Golgi

MHC I

Displayed MHC I +

peptide recognized by cytotoxic T-cell (CD8+)

How MHC-I delivers the peptides on cell surface ? (Endogenous Pathway)

MHC-I

Notatki:

How MHC class-I delivers peptides on the cell surface? Proteins degraded by proteasome enter Endoplasmic Reticulum via TAP (Transporter associated with Antigen Processing), where they bind to MHC-I. MHC-I – peptide complex is then carried by golgi and presented on the cell surface via vesicles. Cytotoxic CD8+ T-cells recognize this complex and via T-cell receptor. CD8+ T-cell proliferates and releases enzymes like perforin, granulozymes which puncture or degrade the entire cell

• Proteins degraded by proteasome enter ER via TAP, where they bind to MHC-I
• MHC-I + peptide complex is carried by golgi and presented on cell surface
• Cytotoxic CD8+ T-cells recognize this complex and via T-cell receptor
• CD8+ T-cell proliferates and releases enzymes like perforin, granulozymes which puncture or degrade the entire cell

Viral / Intracellular bacteria infected cell / cancer cell has to die (cannot be repaired)

MHC-I

MHC class II

MHC-II

Extracellular bacteria or extracellular pathogens

Drugs bound to proteins

Soluble foreign antigens (allergens)

MHC class II presents peptides derived from …

MHC Class II expression – restricted to Antigen-Presenting Cells (APCs)

Dendritic Cells

Macrophages

B cells

Professional APCs

MHC Class II Expression

Constitutive

Need activation (TLR signalling)

Constitutive

TLR – Toll Like Receptors are pattern recognition molecules on cell surfaces

MHC Class II expression – restricted to Antigen-Presenting Cells (APCs)

Non-Professional APCs

Fibroblasts (skin)

Glial cells (Brain)

Pancreatic beta cells

Thyroid epithelial cells

Vascular endothelial cells

• Deputize professional APCs for short periods
• When? During sustained inflammation
• Require activation for expression of MHC II and costimulatory molecules

Lysosomal enzymes degrade bacterial proteins in phago-lysosomes

3

Toll Like Receptors (TLR)

Bacteria

Flagella

LPS

Lipo

peptides

1

Bacteria

Endosome

Lysosomes

2

Endoplasmic

Reticulum

Invariable chain occupies MHC-II binding site temporarily

4

Antigen Presenting Cell

Lysosomal enzymes also remove the invariable chain

6

Golgi

5

7

• Free MHC II picks up the processed bacterial peptide
• Special vesicular structure delivers the complex on cell surface

CD4+ T-cells

MHC II + peptide

recognized by

T-helper cell

MHC-II

MHC-II: Exogenous pathway – How antigens are recognised, processed and delivered on cell surface?

Notatki:

Recognition: Extracellular pathogens and antigens are captured from the environment by specialised antigen presenting cells (APCs) such as Macrophages and Dendritic cells. APCs use specialised receptors (e.g. Toll Like Receptors TLRs) to recognize specific structures on pathogens such as Lipopolysaccharides, flagella, lipopeptides.

Internalization: This recognition helps in efficient internalization of the pathogens in membrane bound vesicles called endosomes.

Processing of internalized pathogens and generation of peptides: Fusion of endosomes and lysosomes produce special vesicles called phagolysosomes and this allows the lysosomal enzymes degrade the internalized pathogenic antigens into short peptides.

Synthesis of MHC-II molecules and their protection: Class II MHC molecules are synthesized in the Endoplasmic Reticulum and are capped with an invariable chain. The invariable chain blocks the MHC II peptide binding cleft so that no other peptides or proteins within the ER make contact with the cleft.

Transportation of MHC-II: MHC-II with the invariable chain is transported via Golgi apparatus to the phagolysosomes where the processed pathogenic peptides are available (refer step 3)

Peptide binding to MHC-II: Lysosomal enzymes remove the invariable chain from the MHC-II. This makes the MHC-II cleft free and this allows the pathogenic peptides to bind to the MHC-II.

Display of MHC-II-Peptide complex on the cell surface: Fusion of the phagolysosome with the plasma membrane of the APC via vesiculotubular extension allows the delivery of MHC-II-peptide complex to be delivered on the surface of the APC. The MHC-II displayed peptide will now be recognized by T-Helper cell. TH cells proliferate releasing chemokines and switch on the immune network by stimulating CD8+ cells and B-cells.

MHC-I

MHC-II

• Extracellular antigens internalized by antigen presenting cells via endosomes
• Fusion of endosomes and lysosomes allow the lysosomal enzymes degrade the internalized antigens into short peptides.
• MHC-class II with the invariant chain is synthesized in ER, but the chain is later removed by lysosomal enzymes.
• This allows the free MHC-II to bind to the short peptides, which are then transported to the cell surface via special vesicles.
• Displayed MHC-class II + peptide complex is recognized by CD4+ T-cells. T-cells proliferate releasing chemokines and switch on the immune network by stimulating CD8+ cells, B-cells, etc.

MHC-I

MHC-II

Present on all nucleated cells

Present only on antigen presenting cells

Binds endogenous antigens

Binds exogenous antigens

Present antigens (short peptides

8-11 amino acids) to

CD8+ cytotoxic T-lymphocytes

Present antigens (peptides of

11-30 amino acids) to

CD4+ helper T-lymphocytes

Presence of foreign or over abundant (e.g. cancer) antigens induces cell destruction (and is the only way)

Presence of foreign or over abundant (e.g. cancer) antigens induces antibody formation and invites inflammatory cells

SELF-DIRECTED LEARNING # 1

W8_MHC_DR GIRIJA

Red-Blood Cells (RBC) are non-nucleated and do not express MHC. Platelets also lack nucleus, but do they express MHC?

Do platelets express MHC?

RBC

SELF-DIRECTED LEARNING # 2

W8_MHC_DR GIRIJA

We discussed about the mechanisms of antigen presentations by MHC (which is HLA in humans). The below link for research paper could be a very useful source for additional self-directed learning.

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5159193/

• How can the knowledge be translated in to clinical medicine? What are the potential applications? (as a minimum, read this section of the paper: Concluding remarks and future perspectives)

• What is MHC/HLA? What are its functions?
• What are the different types of MHC? What are their structural properties?
• What is the importance of polymorphic and polygenic features of MHC?
• Endogenous pathway: What is the mechanism of antigen processing and presentation by MHC class I.
• Exogenous pathway: What is the mechanism of antigen processing and presentation by MHC class II.
• Summarise the differences between MHC class I and class II.

MHC – Some Sample Questions

SELF READING BUILDING ON THE LECTURE CONTENT

IS VERY IMPORTANT FOR YOUR LEARNING EXPERIENCE AND ALSO FOR THE EXAMINATIONS

Recommended reading

• Peter J. Delves, Seamus J. Martin, Dennis R. Burton and Ivan M. Roitt. ROITT’S ESSENTIAL IMMUNOLOGY; 2011, 12th edition
• Abul K Abbas, Andrew H Lichtman and Shiv Pillai. Cellular and molecular Immunology, Elsevier, 2014, 8th edition
• Owen, Punt and Stranford. Kuby Immunology; Palgrave Macmillian. 2015. 7th edition.

Books

Journal articles

https://www.ncbi.nlm.nih.gov/pubmed/27614798

Mucosal Immunity

Dr Umakhanth Venkatraman GIRIJA

umakhanth.venkatramangirija@dmu.ac.uk

BIOM2004

Inflammation & Immunobiology

Learning Objectives	Learning Outcomes
1. What are the mucosal organs?	Name the major mucosal systems and the organs involved:Gastrointestinal systemRespiratory systemUrogenital systemWhat is a mucosal tissue? What does it secrete?
2. Gastrointestinal System
2.a. Different types of cells, secretory products and their antimicrobial nature	Overview of the GI system and Intestinal Epithelial cellsSpecialized cells: Goblet cells, Stem cells, Paneth cells – their structure, functionsAntimicrobial secretions: Defensins, Phospholipase and lysozyme – What are they? What are their mode of action?
2.b. Antigen sampling, presentation and maintenance of immune tolerance	What are M-cells?How antigens are sampled in the GI system and presented to the immune system? What is the outcome?Importance of Immune homeostasis in the GI systemThe role of Treg cells and IL-10

Mucosal Immunity

Learning Objectives	Learning Outcomes
1. What are the mucosal organs?	Name the major mucosal systems and the organs involved:Gastrointestinal systemRespiratory systemUrogenital systemWhat is a mucosal tissue? What does it secrete?
2. Gastrointestinal System
2.a. Different types of cells, secretory products and their antimicrobial nature	Overview of the GI system and Intestinal Epithelial cellsSpecialized cells: Goblet cells, Stem cells, Paneth cells – their structure, functionsAntimicrobial secretions: Defensins, Phospholipase and lysozyme – What are they? What are their mode of action?
2.b. Antigen sampling, presentation and maintenance of immune tolerance	What are M-cells?How antigens are sampled in the GI system and presented to the immune system? What is the outcome?Importance of Immune homeostasis in the GI systemThe role of Treg cells and IL-10

Mucosal Immunity

Food antigens (Innocuous/safe)

Commensals (Symbiotic microbes)

Pathogen Entry & breaching the intestinal barrier

Immune System does not react

Immune System maintains tolerance

Immune System has to defend

What are the Mucosal organs / systems?

Sinus

Trachea

Lungs

Respiratory Tract

Oral cavity

Oeso

phagus

Stomach

Gastrointestinal

Tract

Intestine

Bladder

Vagina

Uterus

Urogenital

Tract

Kidney

Mammary glands

Lacrymal gland

Salivary

gland

Conjunctiva

Immunobiology, Fig 11.1, 7th edition; Garland Science (2008)

A range of mechanisms: physical, biochemical and immunological

What is Mucosal tissue ?

They cover the cavities in the body and also the blood vessels and organs

Mucus is a thick slippery jelly like fluid:

For example in nose, stomach, urogenital tract

A tissue that is able to “secrete mucus”

Where?

across an epithelial cell layer

Contribute to “immune defence”

Learning Objectives	Learning Outcomes
1. What are the mucosal organs?	Name the major mucosal systems and the organs involved:Gastrointestinal systemRespiratory systemUrogenital systemWhat is a mucosal tissue? What does it secrete?
2. Gastrointestinal System
2.a. Different types of cells, secretory products and their antimicrobial nature	Overview of the GI system and Intestinal Epithelial cellsSpecialized cells: Goblet cells, Stem cells, Paneth cells – their structure, functionsAntimicrobial secretions: Defensins, Phospholipase and lysozyme – What are they? What are their mode of action?
2.b. Antigen sampling, presentation and maintenance of immune tolerance	What are M-cells?How antigens are sampled in the GI system and presented to the immune system? What is the outcome?Importance of Immune homeostasis in the GI systemThe role of Treg cells and IL-10

Mucosal Immunity

Gastrointestinal Tract

Combined total surface area of small and large bowel is about 40m2 (comparable to a studio apartment)

About 1000 different microbial species live in our GI tract and 1014 bacterial cells in our gut; they are commensals or friendly microbes

Physical barriers and Secretions

Mucus

Antimicrobial secretion

1

Connective tissue

Muscle tissue

Epithelial cell layer

2

Villi

Helps in nutrient absorption and also makes it difficult for pathogenic invasion

Gastrointestinal Tract

T-lymphocyte

B-lymphocyte

Macrophage

3

Immune response

• Cellular: MHC class I & II
• Humoral (Ab) response

Lymphoid Tissue (Peyer’s patch)

Gastrointestinal Tract

Intestinal Epithelial Cells – What is special in them?

Epithelial cell

Special cells

Crypt

Lymphoid tissue

(Peyer’s patch)

Goblet (cup shaped) cells

Present in the crypt of the epithelium

• Secrete MUCUS
• Microbial infection leads to transient excess mucus secretion (within milliseconds)

95% water + 5% Mucins

Mucins are heavily glycosylated proteins; Glycosylation gives mucus the viscosity and also protect mucins from protease degradation

Mucins bind to microbes and eliminate them

19 different type of mucins

MUCUS

Goblet cells

Consistent excess

mucus production

over weeks or months

could be indication of cancer

• Paneth cells present in the crypt along with stem cells
• Paneth cells functionally similar to neutrophils
• Stem cells have a role in epithelial replenishment

Paneth cells

Stem cells

Paneth and Stem cells

Defensins

(Antimicrobial peptides)

Strongly hydrophobic

Positively charged

Antimicrobials secreted by Paneth cells

Small:

18-45 amino acids

• -defensins (secreted by paneth cells and neutrophils)
• -defensins

DNA/RNA functions interfered

Cell membrane disrupted & Cell contents leak

DNA

RNA

Cell membrane

(-ve charge)

Defensin (+ve charge)

Microbe

How do Defensins work?

Lysozyme

(Muraminidase)

• Binds to N-acetyl muramic acid of bacterial cell wall
• Cell wall integrity lost
• Kills bacteria

Phospholipase A2

• Binds to bacterial cell membranes
• Bacterial cellular lysis and death

Other Antimicrobials

Learning Objectives	Learning Outcomes
1. What are the mucosal organs?	Name the major mucosal systems and the organs involved:Gastrointestinal systemRespiratory systemUrogenital systemWhat is a mucosal tissue? What does it secrete?
2. Gastrointestinal System
2.a. Different types of cells, secretory products and their antimicrobial nature	Overview of the GI system and Intestinal Epithelial cellsSpecialized cells: Goblet cells, Stem cells, Paneth cells – their structure, functionsAntimicrobial secretions: Defensins, Phospholipase and lysozyme – What are they? What are their mode of action?
2.b. Antigen sampling, presentation and maintenance of immune tolerance	What are M-cells?How antigens are sampled in the GI system and presented to the immune system? What is the outcome?Importance of Immune homeostasis in the GI systemThe role of Treg cells and IL-10

Mucosal Immunity

M-cells

Specialized epithelial cells (similar

to macrophages)

Present above organized lymphoid

follicles called payer’s patches

Have irregular small villi

Coated with glycolipids and proteins;

help them interact with antigens and microbes

Peyer’s patch (Lymphoid tissue)

How do M-cells function?

Antigens

Bacteria

• M-cells can uptake antigens as well as whole bacteria by a process similar to phagocytosis
• Antigens sampled by professional antigen presenting cells (e.g. Dendritic cells, macrophages)

Immune signalling following M-cell

Phagocytosis/Pinocytosis/Transcytosis

CD4 +

Helper

T-cell

IL-2

IL-2

CD4 +

Helper

T-cell

CD4 +

Helper

T-cell

CD4 +

Helper

T-cell

T-cell proliferation

B-cell

Pathogens /

Infections

IL-2

IL-2

B-cell

B-cell

B-cell proliferation

Y

Y

Y

Notatki:

Phagocytosis – It is cell eating or engulfment of other cells; Pinocytosis – is cell drinking during which a cell absorbs some extra cellular fluid that contain small solutes and brings them inside; Transcytosis – transcellular transport of macromolecules

• Antigen presenting cells (Dendritic cells) presenting a pathogenic peptide via MHC-Class II stimulates CD4+ T-cell to secrete IL-2.
• IL-2 signal leads to T-cell and B-cell proliferation mounting an immune response against pathogens.
• MHC class I presentation will lead to CD8+ cell proliferation (not ideal for the mucosal system, but where essential, this has to happen)

Epithelial cell layer

Villi

Gastrointestinal Tract

B-cell

T-cell

Interleukin-10 (IL-10) maintains immune homeostasis

TREG

IL-10

IL-10

IL-10

IL-10

• Dendritic cells constantly sample antigens by protruding between epithelial cells.
• Sampling of commensals or non-pathogenic antigens and presentation to T-cells, render the T-cells to become T-regulatory cells (TREG).
• TREG then secrete IL-10 (Interleukin-10) which is anti-inflammatory (stops inflammation).

Failure of immune balance / homeostasis leads to inflammatory bowel disease and other intestinal disorders

SELF-DIRECTED LEARNING # 1

W11_MUCOSAL IMMUNITY

In this week-11 lecture, we briefly discussed about defensins, the types of defensins and how can they defend against microbes.

You have also learnt about complement in an earlier lecture.

Human Neutrophil Peptide-1, one of the defensins, also interplays with complement. Below paper link would be an useful reading resource. If you do not get access to full paper, at least read the abstract.

https://www.ncbi.nlm.nih.gov/pubmed/17448537

• Which components of complement do defensins interact with?
• What is the outcome of defensin-complement interaction?

Learning Objectives	Learning Outcomes
3. Respiratory System
2.a. Lymphoid organs/glands of airways	Importance and the functions ofNasal Associated Lymphoid Tissue (NALT)TonsilsAdenoids
2.b. Epithelial layers of different airways	Common infectious diseases in the respiratory tractCells and macromolecules associated with trachea, bronchioles, alveoliPulmonary Surfactant: What is the composition? What are Surfactant Proteins? What is their structural architecture? How do they eliminate pathogens?Respiratory Distress Syndrome
3. Urogenital System
Brief overview	Key components that provide immunity:Antibodies, Antimicrobial peptides, NK cells, Neutrophils
4. Antibody Response in the Mucosal System	Properties of IgA and secretory mechanism into lumenClass switch recombination: signalling and mechanism

Mucosal Immunity

Learning Objectives	Learning Outcomes
3. Respiratory System
2.a. Lymphoid organs/glands of airways	Importance and the functions ofNasal Associated Lymphoid Tissue (NALT)TonsilsAdenoids
2.b. Epithelial layers of different airways	Common infectious diseases in the respiratory tractCells and macromolecules associated with trachea, bronchioles, alveoliPulmonary Surfactant: What is the composition? What are Surfactant Proteins? What is their structural architecture? How do they eliminate pathogens?Respiratory Distress Syndrome
3. Urogenital System
Brief overview	Key components that provide immunity:Antibodies, Antimicrobial peptides, NK cells, Neutrophils
4. Antibody Response in the Mucosal System	Properties of IgA and secretory mechanism into lumenClass switch recombination: signalling and mechanism

Mucosal Immunity

• Rhinovirus
• Respiratory Syncytial virus (RSV)
• Parainfluenza virus
• Influenza virus

Infectious

Respiratory Diseases

Upper respiratory tract

Examples

• Streptococcus pneumoniae
• Mycobacterium tuberculosis
• Haemophilus influenzae

Lower respiratory tract

Examples

Tonsils

Adenoid

NALT

• Tonsils and Adenoid are small glands
• Antigens are directly delivered and processed

Nasal Associated Lymphoid Tissue

• First lymphoid site that contacts antigens from the environment

Lymphoid organs of Airways

Tonsils

Adenoid

Surface area of tonsil crypts is ~300cm2

Maximizes the chances for antigen processing and clearance before pathogens can access respiratory tract

Ideally suited to sample antigens entering the airways

Learning Objectives	Learning Outcomes
3. Respiratory System
2.a. Lymphoid organs/glands of airways	Importance and the functions ofNasal Associated Lymphoid Tissue (NALT)TonsilsAdenoids
2.b. Epithelial layers of different airways	Common infectious diseases in the respiratory tractCells and macromolecules associated with trachea, bronchioles, alveoliPulmonary Surfactant: What is the composition? What are Surfactant Proteins? What is their structural architecture? How do they eliminate pathogens?Respiratory Distress Syndrome
3. Urogenital System
Brief overview	Key components that provide immunity:Antibodies, Antimicrobial peptides, NK cells, Neutrophils
4. Antibody Response in the Mucosal System	Properties of IgA and secretory mechanism into lumenClass switch recombination: signalling and mechanism

Mucosal Immunity

CLARA cells

Bronchiole

Small airways

Surfactant

Trachea

GOBLET cells

Large airways

Cilia

SP-A,B,C,D

Alveoli

Type I cells

Type II cells

Epithelial layers of different airways

SP = Surfactant Protein

Pulmonary Surfactant =

Phospholipids

+

Proteins

(Surfactant proteins)

Pulmonary Surfactant maintains the surface tension in the airways

• Hydrophobic peptides
• Interact with phospholipids to lower the surface tension within alveolus

Surfactant proteins

SP-A

SP-D

SP-B

SP-C

• Glycoproteins
• Immunomodulatory properties

N-terminal domain (cysteine rich)

Collagen domain

Carbohydrate Recognition Domain

(CRD)

Neck

CRD recognizes and binds to

• carbohydrate targets (mannose, fucose) on pathogens
• DNA, Phospholipid and other protein structures on apoptotic cells

X 6 =

SP-A (Hexamer)

SP-D (Tetramer)

Surfactant Proteins SP-A and SP-D are multimeric

and recognize a range of ligands

SP-A

Pathogen

Pathogen

SP-A (CRD) binds to mannose / fucose moieties on pathogens, undergoes a conformational change to facilitate binding

Multiple SP-A and SP-D can bind to the pathogen, cause aggregation and eliminate them by biophysical means (via cough and sputum)

Pathogen elimination

mechanism – 1

• SP-A and SP-D bind to the pathogens
• Macrophages have receptors for SP-A and SP-D, which then present the bound pathogens or antigens for phagocytosis

Pathogen

Pathogen elimination

mechanism – 2

Macrophages with SP-A and

SP-D receptors

Normal

alveoli

Both SP-A and SP-D can bind to DNA, exposed proteins or phospholipids of apoptotic cells in the alveolar region and help in their elimination by phagocytosis

Apoptotic cells with blebs, exposed cell membrane and DNA

SP-A

SP-D

Alveoli collapse RDS

Respiratory Distress Syndrome

Lungs

Airway

Normal

alveoli

Collapsed

alveoli

Common in babies born <34 weeks of gestational age develop RDS

Lungs have not developed fully enough to produce surfactant (which normally keeps the alveoli open after exhaling)

If surfactant is not present, baby has to work hard to reopen alveoli

Interesting Research Facts

• Spike-protein (also called as S-protein) of Corona virus is recognised by SP-D
• SP-D receptors on phagocytes recognise the SP-D bound to Corona virus
• Corona virus should be engulfed by the phagocytes

Envelope-protein

Spike-protein

Membrane-protein

https://www.frontiersin.org/articles/10.3389/fmed.2020.00254/full

Interesting Research Facts

https://www.researchgate.net/publication/6410295

Seems easy

But the battle is complex

Because, Corona virus/cytokine storm can destroy the alveolar cells leading to reduced blood oxygenation, impaired surfactant production including SP-D, fibrosis, oedema and respiratory failure

Corona virus

Cytokine storm

Learning Objectives	Learning Outcomes
3. Respiratory System
2.a. Lymphoid organs/glands of airways	Importance and the functions ofNasal Associated Lymphoid Tissue (NALT)TonsilsAdenoids
2.b. Epithelial layers of different airways	Common infectious diseases in the respiratory tractCells and macromolecules associated with trachea, bronchioles, alveoliPulmonary Surfactant: What is the composition? What are Surfactant Proteins? What is their structural architecture? How do they eliminate pathogens?Respiratory Distress Syndrome
3. Urogenital System
Brief overview	Key components that provide immunity:Antibodies, Antimicrobial peptides, NK cells, Neutrophils
4. Antibody Response in the Mucosal System	Properties of IgA and secretory mechanism into lumenClass switch recombination: signalling and mechanism

Mucosal Immunity

Urogenital Tract

• Lacks M-cells
• IgG and also IgA dominate the mucosal urogenital tract (while IgA is the dominant in GI and Respiratory tract)
• Antimicrobial defensins, lactoferrin, lipcalin and Tamm-horsfall protein (THP) exclusively binds to fimbriae and enhances bacterial washout via urine
• Natural Killer Cells and Neutrophils play a major role in pathogen elimination by direct killing

Learning Objectives	Learning Outcomes
3. Respiratory System
2.a. Lymphoid organs/glands of airways	Importance and the functions ofNasal Associated Lymphoid Tissue (NALT)TonsilsAdenoids
2.b. Epithelial layers of different airways	Common infectious diseases in the respiratory tractCells and macromolecules associated with trachea, bronchioles, alveoliPulmonary Surfactant: What is the composition? What are Surfactant Proteins? What is their structural architecture? How do they eliminate pathogens?Respiratory Distress Syndrome
3. Urogenital System
Brief overview	Key components that provide immunity:Antibodies, Antimicrobial peptides, NK cells, Neutrophils
4. Antibody Response in the Mucosal System	Properties of IgA and secretory mechanism into lumenClass switch recombination: signalling and mechanism

Mucosal Immunity

Antibody immune response

dominates

mucosal system

IgG IgA IgM IgE IgD

Systemic antibody levels

Mucosal antibody levels

Relative %

IgG IgA IgM IgE IgD

IgG is the dominant Ab in Systemic response

IgA is the dominant Ab in Mucosal response

IgA

IgA

IgA

IgA

IgA

IgA

Resistant to proteases

Stable in acidic environments of GI tract

Higher affinity to antigens

Less inflammatory: good for GI (binds very weakly to complement)

Secretory component is antimicrobial

J-chain

Dimeric

IgA

Plasma B cells are White Blood Cells (WBCs) secreting large volumes of Antibodies (Ab)

Two IgA molecules linked together by a third molecule called the Joining chain (J-chain)

1

2

3

4

Dimeric IgA can bind 4 antigens !

Antigen-IgA complex agglutinates in the lumen

(IgA DOES NOT activate COMPLEMENT)

Clearance via Peristaltic movement

Peristalsis – contraction and relaxation of muscles to pass the food through GI tract and finally the waste

Agglutination of antigens and elimination by peristalsis is a better choice than complement activation, because the latter could be more stressful to the system in a mucosal area

Dimeric IgA – an effective mucosal antibody

Dimeric IgA binds to the poly Ig receptor (secretory component) on epithelial cell and taken up by Endocytosis

Epithelial cell

Lumen (food pipe)

Apical

Surface

Basolateral Surface

Plasma cell in the lymphoid tissue secretes dimeric IgA

Dimeric IgA + extracellular domain of poly Ig receptor RELEASED INTO THE LUMEN

Naive Plasma-B cells express IgM or IgD

IgD

IgM

In a mucosal immune response, it shifts to IgA

IgA

How

Antibody Class Switching

Antibodies

Heavy chain

Light chain

C

C

C

C

C

C

V

V

V

V

Ag

Ag

Constant

region

Variable region detects different antigens from bacteria, virus, cancer cell

and this variability is formed by hyper mutation (VDJ recombination)

• Carries out the effector functions by interacting with immune network
• This determines the type of antibody e.g. IgM, IgG, IgA, IgD and IgE

Class Switching

Basics

V D J

IgM

IgD

IgG

IgA

IgE

S

S

S

S

S

S

S

S

V D J

IgA

Class switch recombination

allows the heavy chain gene coding for IgA antibody

IgA

V D J

DNA repair

DNA repair

AID

AID

AID

AID

2. Upon breakage, the intervening sequences will be lost. VDJ and IgA sequences are then recombined by class switch recombination and DNA repair mechanisms. This leads to secretion of IgA antibody.

(this intervening sequence will be lost)

1. Upon receiving the appropriate cytokine signal, Activation Induced cytidine Deaminase makes double strand breaks in S (Switch) regions upstream of IgA and IgM

T-cell

B-cell

Pathogen

Gamma-Interferon

Y

IgG

IL-4

Y

Y

IgA

TGF-Beta

IgE

Y

• B-cell normally makes IgM and IgD antibodies. Upon receiving an appropriate cytokine signal (which depends on the type of T-cell), B-cell switches to form a different class of antibody (the above list only contains example cytokines). This is called Antibody Switching.
• B-cell then transforms into plasma cell and a plasma blast produces enormous number of the specific antibody

T-Helper cell 1

T-Helper cell 2

T-regulatory cells

Depending on the pathogen and site of infection

Summary

Gastro intestinal, respiratory and uro-genital tracts form the major components of mucosal systems in our body.

Physical barriers (villi, M-cells, goblet cells) and antimicrobial secretions (defensins, lysozyme, phospholipase) try to maintain the ever active GI tract free of infections.

T-regulatory cells help to maintain immune tolerance via IL-10 secretion. This helps the mucosal immune system to stop constant inflammatory response in the GI tract.

Mucosal Immunity

Summary

While cell mediated immune response has a role to play in mucosal immune defence, it is the humoral (antibody) mediated response which dominates.

IgA is the dominant antibody in GI and respiratory tract, while both IgG and IgA dominate the urogenital tract.

Epithelial cells of mucosal system comprise many special cells which secrete antimicrobials that help in fighting infections.

Antibody class switching is the mechanism used by B-cells to produce IgA in the mucosal surface which transfer to the lumen by endocytosis.

Mucosal Immunity

• What are the various mucosal organs in our body?

Mucosal Immunity (part-1) – some sample questions

1. Mucosal organs/systems

2. Physical barriers and Secretions

3. Antigen sampling and immune response

4. Maintenance of immune tolerance

• What are goblet cells and stem cells in the mucosal lining?
• What is mucus? Outline how it provides defence against pathogens.
• What are Paneth cells? What is their role in mucosal immunity?
• Describe the various antimicrobial secretions that support our immune system in the gastro intestinal system.
• Describe the role of M-cells in antigen sampling and explain the fate of such antigens.
• Explain how immune homeostasis or tolerance is maintained in the gastro intestinal system.

Mucosal Immunity (part-2) – Practice questions

• What features of IgA make it an ideal antibody in mucosal immunity?
• Explain the mechanism of transfer of IgA across the epithelial surface.
• What is Antibody Class Switching? What are the major cytokine signals that mediate antibody class switching?

Antibody response in the mucosa

Immune response in Respiratory tract

Immune response in Urogenital tract

• What are the major structural features and their associated immunological role in the respiratory tract ?
• What is the composition of Pulmonary surfactant?
• What are the different types of Surfactant proteins? Explain their role in airway immunity.
• What is Respiratory Distress Syndrome. Why is it caused?

• What are the major immunological features of urogenital system?

Reading

Books

• Peter J. Delves, Seamus J. Martin, Dennis R. Burton and Ivan M. Roitt. ROITT’S ESSENTIAL IMMUNOLOGY; 2011, 12th edition
• Abul K Abbas, Andrew H Lichtman and Shiv Pillai. Cellular and molecular Immunology, Elsevier, 2014, 8th edition
• Owen, Punt and Stranford. Kuby Immunology; Palgrave Macmillian. 2015. 7th edition.

BIOM2004 W2 Lecture 2 Introduction to the Immune System Dr R Furmonaviciene • Please choose the best definition of Immune System : • Immune system is composed of organs, cells and cellular networks; • Immune system is composed of organs, cells and antibodies; • Immune system is composed of organs, cells and sub-cellular structures BIOM2004 W1 Revision MCQ: • Learning Outcomes: • Discuss the key events of an immune response to bacterial invasion • Compare and contrast innate and adaptive immunity • Actively participate in pre-session, during-session and post-session learning; to start using OneClass Notebook (see Blackboard) BIOM2004 W2 Lecture 2 Antigens Immune system is activated by danger signals Immune system is activated by molecular patterns Viruses and bacteria invade by using their surface proteins to attach to host cells or they produce proteins and hydrophobic molecules like LPS to damage host cells Proteins and other molecules which activate immune system are called antigens Cells involved in immune response recognise antigens by using their receptors Receptors usually bind to small areas of antigens, called epitopes Antigens Summarise key events here: Example of an Immune Respose: What Happens When We Get a Splinter? Summarise key events here: Splinter and Bacterial Invasion Splinter The barrier of skin is damaged The cells are injured The splinter is covered in bacteria Bacteria can easier enter the tissues and blood stream Danger signals will attract immune cells Innate and possibly adaptive immune response will be initiated Defensins, phagocytes and dendritic cells may be activated T cells and B cells may participate in defense Immune memory cells may be formed Bacteria gets eliminated Tissues heal Immune response stops Example of an Immune Respose: What Happens When We Get a Splinter? Key Events in More Detail Antigen presentation MHC class molecules on dendritic cells pick up antigenic peptides and present them to T cells waiting in the lymph nodes; This activates T cells and they enter blood stream and travel to the site of infection to clear the pathogens B Lymphocytes are also activated in the lymphnode. When informed about danger and activated, T cells form clones (or groups of identical T cells with the right specificity) T helper cells inform B cells, and B lymphocytes also form clones. Effective Immune Response After the infection is cleared, immune response needs to be switched off (autoimmune diseases may result if this is not happening) Memory cells are left after the infection is cleared, so that immune system can remember pathogen and react faster next time this pathogen comes across Therefore secondary immune response (response to a seen pathogen) is stronger than primary response (response to a new pathogen) Phases of an Immune Response Primary and Secondary Immune Response Innate and Adaptive Immunity Compare and contrast Innate and Adaptive immunity Adaptive immune responses develop later and consist of activation of lymphocytes. The kinetics of the innate and adaptive immune responses are approximations and may vary in different infections. Innate and adaptive immunity Cellular Immune response Humoral Surprise Task: Which Splinter is Better: Glass Splinter or Wooden Splinter? Innate and Adaptive Immunity: How Immune Response is Switched Off? Task: Read the following paper https://www-proquestcom.proxy.library.dmu.ac.uk/docview/2434147450?Op enUrlRefId=info:xri/sid:summon&accountid=10472 Damage-associated molecular patterns in trauma Borna, Relja; Land Walter Gottlieb.European Journal of Trauma and Emergency Surgery; Heidelberg Vol. 46, Iss. 4, (Aug 2020): 751-775. DOI:10.1007/s00068-019-01235-w and answer the question below: How Can Danger-Associated Molecular Patterns (DAMPs) promote tissue healing? Please place your answer in OneClass Notebook on Blackboard Can you briefly explain the picture? Immune system is regulated by stimulating and suppressive molecular patterns Activation of Immune System We are constantly surrounded • by bacteria • viruses • parasites harmful chemicals If this is true, how do we survive? Activation of Immune System: Which Way to Go? Post-Lecture Task Read the following research paper and discuss briefly The innate and adaptive events of immune response to COVID-19. https://www.frontiersin.org/articles/10.3389/fimmu .2020.01662/full Optional catch-up time: text me via MS Teams BIOM2004 W3 Lecture 3 Cytokines Dr R Furmonaviciene • Learning Outcomes: • Discuss the definition and functions of cytokines • Discuss briefly how cytokines can be dis-regulated • Actively participate in pre-session, during-session and post-session learning; to start using OneClass Notebook (see Blackboard) BIOM2004 W3 Lecture 3 Write your definition of Cytokines here: Bite 1 Cytokines: Groups and Functions Soluble Mediators = cytokines Membrane receptors and counter-receptors How do cells communicate? stimulus Cytokine gene Cytokine Cytokine Receptor Gene activation Cytokine-producing cell Target cell Biological effects Autocrine action Paracrine action Endocrine action Circulation Cytokine effects Activated macrophage IL-12: activates NK cells, induces differentiation of CD4+ Th cells into Th1 cells IL-8: Chemotactic factor – recruits neutrophils, basophils and T cells to site of infection Local Effects Systemic Effects IL-1: Activates vascular endothelium and lymphocytes Local tissue destruction and increases access of effector cells into tissue TNF: Activates vascular endothelium and increases vascular permeability – increased entry of IgG complement and cells to tissue and increase drainage to lymph nodes IL-6: Lymphocyte activation and increased antibody production IL-1: Fever and production of IL6 TNFa: Fever, mobilisation of metabolites, shock IL-6: Fever, acutephase protein production Inflammatory cytokines Cytokine definition Cytokine is the general term for a large group of molecules involved in signalling between cells during immune responses. Cytokines signal between lymphocytes, phagocytes, and other cells of the body. • All cytokines are proteins or glycoproteins (8-25kDa). • The different cytokines fall into a number of categories. The principal subgroups are: interferons, interleukins, chemokines and colony-stimulating factors. Main functions of cytokines 1) Stimulators of immature lymphocyte growth and differentiation 1) Mediators of natural immunity 1) Regulators of mature lymphocyte activation, growth and differentiation 1) Regulators of immune-mediated inflammation Cytokine redundancy • Redundant = different cytokines may have the same function, e.g.: TNFalpha IL-1beta + + fever induction Cytokine pleotropism • Pleotropic = one cytokine having many functions, e.g.: TNFalpha + fever induction + induction of adhesion molecule expression on endothelium + induction of leukocyte adhesion Cytokine regulation • Production of antagonistic cytokines, e.g. IL-10 inhibits the synthesis of TNFalpha • Production of dedicated inhibitor molecules, e.g. IL-1 receptor antagonist (IL-1ra) is produced by the same cells that secrete IL-1; IL-1 and IL-1ra compete for the same receptor • Cytokines may be regulated by activating proteases, e.g. during activation the amino terminus of TGFbeta is removed to release the active form of the cytokine Interferons Interferons • INTERFERONS LIMIT THE SPREAD OF CERTAIN VIRAL INFECTIONS. IFNs induce a state of antiviral resistance in uninfected cells. They are produced very early in infection and are important in delaying the spread of a virus until such time as the adaptive immune response has developed. • one group of interferons (IFNα and IFNβ) is produced by cells that have become infected by a virus; • another type, IFNγ, is released by activated Th1 cells. Anti-virus cytokine response Interferons (IFNs) Induce resistance to viral replication in all host cells Increase MHC Class I expression and antigen presentation in all cells Activate NK cells to kill virus-infected cells Virus-infected host cell Interleukins TCR CD3 CD4 CD4+/T helper cell TCR CD3 CD4 Interleukin-2 (IL-2) Interferon gamma (IFN) TCR CD3 CD4 Interleukin-5 (IL-5) Interleukin-13 (IL-13) Interleukin-4 (IL-4) Th1 (T helper 1) – Cell mediated immune responses, e.g. intracellular bacteria, activate phagocytes Th2 (T helper 2) – Humoral immune responses, e.g. IgE production, activate B cells Cytokines can be used to define T cell subsets • INTERLEUKINS are a large group of cytokines produced mainly by T cells Many interleukins cause other cells to divide and differentiate. CYTOKINE SECRETION FROM T-helper CELLS CONTROLS B CELL PROLIFERATION AND DIFFERENTIATION B cell development is influenced by cytokines from T cells and APCs, and by direct interactions with Th2 cells. IL-4 is most important in promoting division, and a variety of cytokines including IL-4, IL-5, IL-6, IL-10, and IFNγ influence development into antibody-forming cells (AFCs). Colony stimulating factors Bone Marrow Blood Pluripotent hematopoietic stem cell neutrophil monocyte GM-CSF Granulocyte/ macrophage progenitor M-CSF G-CSF Granulocyte/macrophage colony stimulating factor (GM-CSF) Macrophage colony stimulating factor (M-CSF) Granulocyte colony stimulating factor (G-CSF) CS factors • COLONY STIMULATING FACTORS (CSFs) DIRECT THE DIVISION AND DIFFERENTIATION OF LEUKOCYTE PRECURSORS Chemokines Chemokines • Chemokines regulate normal cell traffic, tissue architecture, and inflammatory cell recruitment. The two largest chemokine families are designated CCL or CxCL, distinguished by the arrangement of their cysteine residues. CCL chemokines attract monocytes, lymphocytes and eosinophils. Most CxCL chemokines attract neutrophils, although some act on lymphocytes. • CCL11 – Eotaxin – attract eosinophils • CxCL8 – IL-8 – attracts neutrophils Other cytokines • OTHER CYTOKINES INCLUDE TNF α AND TNF β, AND TGF β Tumor necrosis factors TNFα and TNFβ, and transforming growth factor-β (TGFβ), have a variety of functions, but are particularly important in mediating inflammation and cytotoxic reactions. What Can Go Wrong with Cytokines? Discuss an example of cytokine dis-regulation here: How does cytokine storm start? Toxic shock syndrome (cytokine storm) This occurs due to overproduction of cytokine during bacterial infection. This condition may develop within few hours following infection (e.g. by E coli, Klebsiella pneumoniae, Neisseria meningitidis). The symptoms of septic shock include drop in blood pressure, diarrhea, fever and hemorrhagic blood clotting in various organs. The reason for septic shock is bacterial endotoxins stimulate macrophages to over produceIL-1andTNF-alpha. Anti-cytokine therapy in RA • Rheumatoid arthritis (RA) is an autoimmune disease characterised by inflammation of the joints and a progressive loss of joint function. • New therapies for RA include the use of anti-cytokine reagents to block the action of TNFalpha or IL-1beta, e.g. Etanercept is a recombinant protein consisting of a portion of a TNF receptor fused to the Fc portion of human immunoglobulin IgG to prolong its circulating halflife. Disfunctions of cytokine receptors Polymorphisms in the genes encoding cytokine receptors have been shown to correlate with an increased susceptibility to: • infection; • severe combined immune deficiency (SCID); and • inflammatory conditions. • E.g. mutations in the IL-7R α chain result in a reduced number of T cells; • whereas those with deficiency in the common cytokine receptor γ chain (γc), a component of IL-2, IL-4, IL-7, IL-9, and IL-15 receptors, have reduced numbers of T and NK cells and impaired B cell function, in part attributable to the lack of T cell help • Further examples are the mutations in the IFNγ receptor (IFNγR) or IL-12 receptor (IL-12R), which increase susceptibility to mycobacterial infection. BIOM2004 W4 Lecture 4 Cells of Innate Immune Response Dr R Furmonaviciene • Learning Outcomes: • Discuss the cell types involved in innate immune response • Discuss briefly how these cells recognise antigens • Actively participate in pre-session, during-session and post-session learning; to start using OneClass Notebook (see Blackboard) Write your summary here: Bite 1 Cells of Innate Immune Response: Cell types and Functions Learning Outcomes To discuss the functions of NK cells, phagocytes, dendritic cells What Key Cells Types Participate in an Immune Response? The mechanisms of innate immunity provide the initial defense against infections. Adaptive immune responses develop later and consist of activation of lymphocytes. The kinetics of the innate and adaptive immune responses are approximations and may vary in different infections. Innate and adaptive immunity Cellular Immun e respons e Cellul ar Humora l Humora l Key Cells and Proteins Involved in an Immune Response •Innate immune response involves key cell types: • Dendritic cells, phagocytes, NK cells, basophils, eosinophils •Adaptive immune response involves • B cells and T cells (lymphocytes) • Cytokines (defensive proteins and peptides) are produced by all cells mentioned • Antibodies are produced by B cells only Cells of the innate immune system: Neutrophils have multilobed nucleus, because of which these cells are also called polymorphonuclear leukocytes, and the faint cytoplasmic granules. Phagocytose pathogens Inflammatory cells Phagocytes: Neutrophils, Monocytes and Macrophages Microbes may be ingested by different membrane receptors of phagocytes; some directly bind microbes, and others bind opsonised microbes. The microbes are internalised into phagosomes, which fuse with lysosomes to form phagolysosomes, where the microbes are killed by reactive oxygen and nitrogen intermediates and proteolytic enzymes. NO, nitric oxide; ROS, reactive oxygen species. Phagocytos is A. NK cells recognize ligands on infected cells or cells undergoing other types of stress, and kill the host cells. In this way, NK cells eliminate reservoirs of infection as well as dysfunctional cells. B. NK cells respond to IL-12 produced by macrophages and secrete IFN-gamma, which activates the macrophages to kill phagocytosed microbes. NK cell functions Role of dendritic cells in antigen capture and presentation Receptors of Innate Recognition Receptors have broad recognition (poly-specific) Dendritic Cell Toll-like receptors (TLRs) recognize a wide variety of PAMPs The basic steps in TLR signaling, illustrated only for TLR2 and TLR4, are applicable to all TLRs. TLRs https://www.frontiersin.org/articles/1 0.3389/fimmu.2016.00556/full Innate and Adaptive Immunity Timeline (Paper link – optional extra reading) What Can Go Wrong with Cells of Innate Immune Response? Dendritic cells and Monocytes in Atherosclerosis Immunity 2017 47, 621-634DOI: (10.1016/j.immuni.2017.09.008) https://www.cell.com/immunity/fullte xt/S1074-7613(17)30419-3 Macrophages and DCs may contribute to plaque formation Paper link – optional extra reading Do you remember an example of a cytokine and it’s function? Inflammation and Immunobiology (BIOM2004) T CELLS Dr Naomi Martin HB 1.32 naomi.martin@dmu.ac.uk • Aims: to learn more about T lymphocytes • Learning objectives: • Describe and discuss T cell structure and function • Describe and discuss T cell development • Describe and discuss T cell activation and the function of different types of T cell LEARNING AIMS & OBJECTIVES • This defence can be NON -SPECIFIC or SPECIFIC • Non -specific mechanism of defence • Does not distinguish between infective agents THE IMMUNE SYSTEM LO: to learn more about T lymphocytes • This defence can be NON -SPECIFIC or SPECIFIC • Specific mechanisms of defence • Responds specifically to particular infective agents THE IMMUNE SYSTEM LO: to learn more about T lymphocytes • A small leukocyte (white blood cell) with a single round nucleus, occurring especially in the lymphatic system • Role in specific immune defence • MAIN JOB IS TO FIGHT INFECTION LYMPHOCYTES LO: to learn more about T lymphocytes • Cellular immunity is mediated by T cells • Same lineage as B cells – progenitor identical • Depends on where it becomes immunocompetent • T cells develop in the Thymus • T cells do not produce antibodies T LYMPHOCYTES LO: Describe and discuss T cell structure and function • T cells have antigen receptors that are structurally related to antibodies T LYMPHOCYTES LO: Describe and discuss T cell structure and function • T cells have antigen receptors that are structurally related to antibodies T LYMPHOCYTES LO: Describe and discuss T cell structure and function • Develop in the Thymus (in the upper chest) • Each T cell possesses a unique antigen-binding molecule called the T cell receptor (TCR) T LYMPHOCYTES LO: Describe and discuss T cell structure and function • These antigen receptors help recognise antigens only in the form of peptides displayed on the surface of antigen -presenting cells T LYMPHOCYTES LO: Describe and discuss T cell structure and function • Only recognise antigen that is bound to cell membrane proteins called major histocompatibility complex (MHC) molecules. T LYMPHOCYTES LO: Describe and discuss T cell structure and function • A number of different subsets exist – defined by surface antigens, function or cytokine production • MHC class I (found on all nucleated cells) • MHC class II (found on APC) • MHC class III (found on hepatocytes, macrophages) T LYMPHOCYTES LO: Describe and discuss T cell structure and function T CELL DEVELOPMENT LO: Describe and discuss T cell development Thymus section showing lobular organization: This section shows the two main areas of the thymus lobule – an outer cortex of immature cells (C) and an inner medulla of more mature cells (M). T CELL DEVELOPMENT LO: Describe and discuss T cell development • Selection of the T cell repertoire occurs in the thymus • Recognition • CENTRAL TOLERANCE • Mechanism whereby the immune system is impaired in its response to respond to self -antigens • Many T cells are eliminated • Selection mechanisms operate to shape the T -cell repertoire T CELL MATURATION LO: Describe and discuss T cell development Positive selection only T cells with a receptor that bind with affinity to self-peptide MHC survive – others are eliminated by apoptosis – ENSURES MHC RECOGNITION Negative selection T cells with a receptor that bind with high avidity to self-antigen or selfantigen presented by MHC undergo apoptosis – ENSURES SELF-TOLERANCE T CELL MATURATION LO: Describe and discuss T cell development • T cell precursor goes from bone marrow to the thymus • In the cortex of the thymus, positive selection occurs • This is a check to see if the T cells interact with MHC • Cells that are able to interact with MHC receive survival signals • Those that do not interact do not receive a survival signal and die by apoptosis T CELL MATURATION LO: Describe and discuss T cell development • Those T cells which interact with MHC class I are differentiated into CD8 or cytotoxic T cells • T cells which interact with MHC class II are differentiated into CD4 or helper T cells T CELL MATURATION LO: Describe and discuss T cell development • Differentiated T cells now go to the medulla of the thymus • Negative selection occurs in the medulla • This checks how well the T cells bind with self MHC peptides T CELL MATURATION M LO: Describe and discuss T cell development • If this interaction is too strong, the cell will not receive survival signals and will undergo apoptosis • Without this negative selection, self-reactive T cells capable of inducing autoimmune diseases are produced • Mature T cells are then released to the lymph nodes T CELL MATURATION LO: Describe and discuss T cell development • After passing through these checks of positive and negative selection, the T cells are released into the lymph nodes and are now mature naïve T cells T CELL MATURATION LO: Describe and discuss T cell development • On recognition of peptide-MHC by their TCR, a naïve T cell (Th0) becomes activated → differentiate → proliferate • The activation required recognition of antigens displayed on APCs, costimulators and cytokines produced by the APCs and the T cells themselves • These signals tell the cells what to do e.g. APC (DC, macrophage, phagocytes) produce IL12 which activates APC and also induces generation and differentiation on T cells, which then produce IFNɣ and IL2 (activated macrophages and induces MHCII expression, promotes differentiation of memory cells). LO: Describe and discuss T cell activation and the function of different types of T cell T CELL ACTIVATION • They become differentiated into distinct populations LO: Describe and discuss T cell activation and the function of different types of T cell T CELL ACTIVATION • Clustering of surface receptors such as TCR, CD4, CD28 and CD45 results in activation of intracellular signal transducers • Three signals are necessary for full T cell activation • SIGNAL 1: generated by the interaction of MHC -peptide with the TCR • The interaction between the TCR and ag/MHC alone is not enough to sustain the contact between the T cells and APC LO: Describe and discuss T cell activation and the function of different types of T cell T CELL ACTIVATION • SIGNAL 2: generated by the interaction of CD28 on the T cell and members of the B7 family on the APC; this is called the co -stimulatory signal • Integrins and their receptors on the T cell and APC strengthen this interaction so that the TCR and CD28 can receive prolonged and sustained signals LO: Describe and discuss T cell activation and the function of different types of T cell T CELL ACTIVATION • SIGNAL 3: cytokine stimulation • Signals through the integrins also enhance T cell activation LO: Describe and discuss T cell activation and the function of different types of T cell T CELL ACTIVATION • HELPER TH (CD4+ ) cells secrete cytokines which stimulate the proliferation and differentiation of T cells, B cells, macrophages & other leukocytes • Helper T cells release molecules which warn the immune system of the presence of a danger LO: Describe and discuss T cell activation and the function of different types of T cell TYPES OF T CELLS – HELPER TH • In 1986, Mosmann and colleagues observed that individual clones of helper T cells could be separated into two classes depending upon the specific cytokines the cells secrete in response to antigenic stimulation LO: Describe and discuss T cell activation and the function of different types of T cell TYPES OF T CELLS – HELPER TH T.R. Mosmann, et al., “Two types of murine helper T cell clone: I. Definition according to profiles of lymphokine activities and secreted proteins,” Journal of Immunology, 136:2348-57, 1986. • The two helper T cell classes also differ by the type of immune response they produce: • Th1 cells primarily produce interferon (IFN)-ɣ and interleukin (IL)-2 • Th1 cells – generate responses against intracellular parasites such as bacteria and viruses, cell-mediated responses LO: Describe and discuss T cell activation and the function of different types of T cell TYPES OF T CELLS – HELPER TH • Th2 cells produce IL-4, IL-5, IL-6, IL-10, and IL-13 • Th2 cells – produce immune responses against helminths and other extracellular parasites, humoral response e.g. IgE production LO: Describe and discuss T cell activation and the function of different types of T cell TYPES OF T CELLS – HELPER TH • Interestingly, the cytokines produced by each Th subset tend to both stimulate production of that Th subset and inhibit development of the other Th subset. • IFN-ɣ produced by Th1 cells has the dual effect of both stimulating Th1 development and inhibiting Th2 development. • Th2-secreted IL-10 has the opposite effect. LO: Describe and discuss T cell activation and the function of different types of T cell TYPES OF T CELLS – HELPER TH • CYTOTOXIC Tc (CD8+ ) cells kill cells that produce foreign antigens • Attach themselves to other cells in the body, if this cell is diseased or pathogenic, the T cell will either • Force the cell to undergo apoptosis • Secrete enzymes which will kill the cell LO: Describe and discuss T cell activation and the function of different types of T cell TYPES OF T CELLS – CYTOTOXIC TC • Responsible for the direct killing of infected, damaged, and dysfunctional cells, including tumour cells • Once inside cells, these pathogens are not accessible to antibodies and can be eliminated only by the destruction or modification of the infected cells on which they depend • Powerful and accurately targeted LO: Describe and discuss T cell activation and the function of different types of T cell TYPES OF T CELLS – CYTOTOXIC TC • Cytotoxic T cells kill their targets by programming them to undergo apoptosis (nuclear fragmentation) • Recognise • Peptide fragments • MHC I • Cytotoxins LO: Describe and discuss T cell activation and the function of different types of T cell TYPES OF T CELLS – CYTOTOXIC TC https://highered.mheducation.com/sites/00724958 55/student_view0/chapter24/animation__cytotoxic _t-cell_activity_against_target_cells__quiz_1_.html LO: Describe and discuss T cell activation and the function of different types of T cell TYPES OF T CELLS – CYTOTOXIC TC • Calcium-dependent release of specialized lytic granules • e.g. perforin – forms transmembrane pores in target cell membranes • e.g. granzymes – act as digestive enzymes • CD4+ helper T cells bind to MHC class II molecules • Found on mononuclear phagocytes, B cells, dendritic cells • CD8+ cytotoxic T cells bind to MHC class I molecules • Found on all nucleated cells (including cells expressing MHC II) T CELL RECEPTOR LO: Describe and discuss T cell activation and the function of different types of T cell • Consists of 2 polypeptides α and β, or γ and δ • Each polypeptide chain has 2 regions (1 variable, 1 constant) • Each T cell has a unique TCR on its surface • Hundreds of millions • Similar to immunoglobulin chains • Variable and constant regions = diversity T CELL RECEPTOR LO: Describe and discuss T cell activation and the function of different types of T cell • α β • Recognise antigens BUT only in conjunction with MHC proteins (immunoglobulins recognise free antigens) • The complementary determining regions form the binding site for antigen/MHC molecule T CELL RECEPTOR LO: Describe and discuss T cell activation and the function of different types of T cell • Small subset of T cells, about 1- 5% total T cell population • TCR glycoproteins ɣδ, instead of αβ • Enriched (>50 % of the T cell population) in epithelial cell-rich compartments like skin, the digestive tract, and reproductive organ mucosa LO: Describe and discuss T cell activation and the function of different types of T cell TYPES OF T CELLS – GAMMA DELTA Tɣδ • Role in immunoregulation & immunosurveillance • Cytotoxic • Kill infected & activated cells • Engage death receptors (FAS) • Release cytotoxic effector molecules (Perforin) • Undergo functional programming in the thymus • Sense cellular stress • Contribute to different stages of the inflammatory response • Major role in RESOLUTION of the immune response LO: Describe and discuss T cell activation and the function of different types of T cell TYPES OF T CELLS – GAMMA DELTA Tɣδ • Not MHC restricted • Recognise whole proteins rather than peptides • Role in the resolution of the immune response • Functions of γδ T cells differ according to = functional plasticity ➢ their tissue distribution ➢ the structure of their antigen receptors ➢ how and what stage of the immune response they have become activated TYPES OF T CELLS – GAMMA DELTA Tɣδ • Aims: to learn more about T lymphocytes • Learning objectives: • Describe and discuss T cell structure and function • Describe and discuss T cell development • Describe and discuss T cell activation and the function of different types of T cell LEARNING AIMS & OBJECTIVES Adaptive Immunity: B Cells BIOM2004 Week 6 Adaptive Immunity: B Cells How B Cells Contribute to an Immune Response? Learning aims: How do B cells get activated? How different antibody classes protect us from pathogens? A. Light micrograph of a plasma cell in tissue. B. Electron micrograph of a plasma cell. (Courtesy of Dr. Noel Weidner, Department of Pathology, University of California, San Diego, California.) Morphology of Activated B Cells Activated B lymphocytes become plasma cells or activated B cells, secreting immunoglobulins (or antibodies) The activation of B cells is initiated by specific recognition of antigens by the surface Ig receptors of the cells. Antigens stimulate the proliferation and differentiation of the specific B cell clone. Depending on the antigen, different classes of antibodies can be produced. B Cell Clonal Expansion Changes in Antibody Structure during B Cell Activation In the course of immune response, depending on the signals, coming to B cells, antibody structures may change which will result in stronger binding or secretion of different antibody class. Antibody Structure and Function IgG molecule Antibody model by Mike Clark https://www.csap.cam.ac.uk/network/mike-clark/ Antibodies have 2 functions Function 1: To bind specifically to pathogen/antigen – mediated via the variable region (V region). Thereby each antibody recognises a unique antigen (Ag) to give a total repertoire large enough to recognise almost anything. Antigen binding A. This model of lysozyme bound to an antibody molecule. The heavy chains of the antibody are colored red, the light chains are yellow, and the antigen is colored blue. B. A view of the interacting surfaces of lysozyme (in green) and a Fab fragment of a monoclonal anti-hen egg lysozyme antibody (VH in blue and VL in yellow) is provided. The residues of hen egg lysozyme and of the Fab fragment that interact with one another are shown in red. A critical glutamine residue on lysozyme (in magenta) fits into a “cleft” in the antibody. Antigen Binding Cellular Receptor Binding Function 2: To recruit other cells and molecules of the immune system – feature of the constant region (C region) of the Ab – 5 main forms of C region – one for each Ab ‘type’. However, for membrane bound Ab the C region is inserted into the membrane – once V region recognises Ag the C region transmits a signal that activates the B cell. Biological activity Protective Functions of Antibodies Receptors for IgG have either two or three extracellular immunoglobulin domains. Motifs (ITAM, ITIM) on the intracellular segments or on associated polypeptides are targets for tyrosine kinases involved in initiating intracellular signaling pathways. Fc receptors Immunoglobulin Structure Heavy chain Light chain Immunoglobulin G (IgG) Molecular weight approximately 150 kilodalton (kDa) composed of 2 heavy chains of 50kDa each and 2 light chains of 25kDa each heavy chains linked by disulphide bonds and each heavy chain linked to light chain by disulphide bond in any given antibody the 2 heavy chains and the 2 light chains are identical – so each antibody has 2 identical antibody binding regions IgG molecules are cleaved by the enzymes papain (A) and pepsin (B) at the sites indicated by arrows. Papain digestion allows separation of two antigen-binding regions (the Fab fragments) from the portion of the IgG molecule that binds to complement and Fc receptors (the Fc fragment). Pepsin generates a single bivalent antigen-binding fragment, F(ab’)2. Proteolytic fragments of an IgG molecule The 5 classes of immunoglobulins are distinguished by the Constant region of their heavy chains Clas s Heavy chain Subcl asses Light Chain IgG  1, 2, 3, 4 k or l IgM m None k or l IgA  1, 2 k or l IgE e None k or l IgD d None k or l Minor differences in the amino acid sequences of the  and  heavy chains leads to categorisation of subclasses Five classes – G, M, A, E, D Immunoglobulin IgG IgM IgA IgE IgD Normal Levels (mg/dl) 620 – 1400 45 – 250 80 – 350 0.002 – 0.2 0.3 – 3.0 IgG: Most abundant class in serum (about 80%) – IgG1 > IgG2 > IgG3 > IgG4. IgG1 and IgG3 bind with high affinity to Fc receptors on phagocytic cells for opsonisation (IgG 4 intermediate and IgG 2 low). IgG3 is the most effective complement activator (then IgG1; IgG2 less efficient and IgG4 can’t). IgG1, IgG3 and IgG4 readily cross the placenta and have an important role in protecting the fetus (passive immunity). 1) A model of IgG1 2) IgG3 3) IgM H chains have five domains with disulfide bonds cross-linking adjacent Ch3 and Ch4 domains. 4) IgA. The J chain is required to join the two subunits. 5) This diagram of IgD shows the domain structure and a characteristically large number of oligosaccharide units. 6) IgE. Carbohydrate side chains are shown in blue. Different Structures of Different Antibody Classes Immunoglobulin M (IgM) • 5% to 10% of total serum Ig. • Monomeric IgM is membrane bound on B cells. • Plasma cells secrete pentameric IgM (5 monomers held together by a J (joining) chain. • IgM is the first class produced in a primary response to antigen Y Y Monomeric Pentameric (1) In free solution, deer IgM adopts the characteristic star-shaped configuration. (2) IgM antibody (arrow) in ‘crab-like’ configuration with partly visible central ring structure bound to a poliovirus virion. IgA Only 10% to 15% of total serum Ig. BUT predominant class in external secretions (breast milk, saliva, tears and mucus in bronchial, genitourinary and digestive tracts). Daily production of IgA is greater than for any other class. Secretory IgA in secretions – dimer of tetramer with a J chain and secretory component. Binding to bacterial and viral surface antigens prevents attachment of pathogens to mucosal cells. Y Y Mast Cell Fc Receptor specific for IgE Granule IgE Allergen Immunoglobulin E IgE serum levels are elevated in people with parasite infection or allergy (eczema, hay fever, asthma, anaphylactic shock). IgE binds to Fc receptors on blood basophils and tissue mast cells – cross-linking by allergen induces release of granule contents (pharmacologically active mediators). Immunoglobulin D • About 0.2% of total serum immunoglobulin. • Together with IgM is the major membrane bound Ig expressed by mature B cells. • No biological effector function has been described for IgD. Antibodies can be designed and used for diagnostics and therapy Search research papers to find an example of an antibody used in diagnostic test – optional task for your independent extra reading Immunoglobulins (Ig) or antibodies are: • produced by B cells • become secreted – circulating antibodies • when membrane bound act as B cell surface receptor (BCR) • all activated B cells produce a vast array of Ig/Ab with a variety of antigen specificities • BUT each B cell produces Ig/Ab with a single specificity (produced Abs bind one antigen) Summarising Comments Please use module Discussion Board for your questions or message me on MS Teams ☺ BIOM2004 W1 Lecture 1 Introduction to the Inflammation and Immunobiology Module Dr R Furmonaviciene • Learning Outcomes: • To clarify all doubts about the learning goals, study themes and assessments; to be able to tell your colleagues this information • To discuss your ideas about how immune system is activated • To actively participate in pre-session, during-session and postsession learning BIOM2004 W1 Lecture 1 • Learning themes and sessions • Finding your way online • Assessments • Communication • All can be found on Blackboard site of the module, in the module handbook or other information folders BIOM2004 Module Content How many credits? How many lecturers? How many assessments? When is the first assessment due? How many credits? How many credits? How many lecturers? How many lecturers? Find the answer in ‘Staff Contacts’ On Blackboard How many assessments? How many assessments? Look for the answer in the module Template (Information about the module site on Blackboard) Quiz (MCQs) Exam When is the first assessment due? When is the first assessment due? We have formative (unmarked) assessments to help you to prepare for the summative ones (marked) Formative Quiz (MCQ) Week 4 (some examples of MCQs) Summative Quiz (MCQ) Week 29 We will give you all the details closer to the dates – please attend all sessions Study Materials for Lecture 1: • You Tube video about P Matzinger (available on Blackbaord) (compulsory) • Conversation with P Matzinger text (available on Blackboard) • Which answers are right? Quick Quiz about Polly Matzinger after you examined the pre-session material about her ☺ Legends of allergy/immunology: Polly Matzinger Allergy, Volume: 75, Issue: 8, Pages: 2136-2138, First published: 21 January 2020, DOI: (10.1111/all.14191) How immune system gets activated? Immune system is activated by molecular patterns signaling danger, e.g.: bits of RNA or DNA, hydrophobic molecules, proteolytic enzymes What parts of immune system react to danger? P Matzinger mentions lymph nodes, B, T, dendritic cells, MHC molecules as being involved in an immune response Give some examples of danger signals and non-dangerous events (these will not triger immune response) Danger signals: e.g.: allergens which are harmful proteins or they may mimic danger- signalling molecules; microbial, viral proteins Non-dangerous events: development of the fetus, apoptosis during development of the fingers, where unnecessary cells disappear by apoptosis • Structure? • Function? • Activation? Suggest your best definition of the ‘Immune System’… Immune system is composed of organs, cells and molecules Immune system is activated by danger signals Organs, cells and molecules work together as a defensive network Final Task: Read the following paper https://www-proquestcom.proxy.library.dmu.ac.uk/docview/2434147450?Op enUrlRefId=info:xri/sid:summon&accountid=10472 Damage-associated molecular patterns in trauma Borna, Relja; Land Walter Gottlieb.European Journal of Trauma and Emergency Surgery; Heidelberg Vol. 46, Iss. 4, (Aug 2020): 751-775. DOI:10.1007/s00068-019-01235-w and answer the question below: How Can Danger-Associated Molecular Patterns (DAMPs) promote tissue healing? Study Materials for Lecture 2: Read the following paper https://www-proquestcom.proxy.library.dmu.ac.uk/d ocview/2434147450?OpenUrlR efId=info:xri/sid:summon&acc ountid=10472 Damage-associated molecular patterns in trauma Borna, Relja; Land Walter Gottlieb.European Journal of Trauma and Emergency Surgery; Heidelberg Vol. 46, Iss. 4, (Aug 2020): 751- 775. DOI:10.1007/s00068-019- 01235-w and answer the question bl Dr Umakhanth Venkatraman GIRIJA umakhanth.venkatramangirija@dmu.ac.uk Complement in the Immune system C C C C BIOM2004 Inflammation & Immunobiology Learning Objectives Learning Outcomes 1. Complement components & activation • What is complement pathway? • Which cells produce complement proteins? • What are the different types of pathways ? • What are the different target recognition mechanisms? • How do the pathways get activated? • What are the various effector mechanisms and the fate of the target cells? 2. Regulation of Complement • What is Complement Regulation? Why is regulation of complement important? • What are the types of complement regulators? Learn with examples Targets Pathogens • Bacteria • Virus • Fungi • Protozoa Targets Damaged Self-Cells • Physical damage • Chemical damage • Neoplasm Importanc Complement, part of innate immune system, is a network of ~40 different proteins. It can recognise (bind) to and eliminate a wide range of target cells and also bridge adaptive immunity How does ComplemComplement, part of innate immune system, is a network of ~40 different proteins. They (have to) work via defined pathways to carefully eliminate pathogens and not human cells The 40 different proteins have to work in an organised manner What are Complement Pathways? • Biochemical pathways that are part of innate immune system • They ‘recognise’ pathogens or target cells via different ways • They ‘function’ via enzymatic cascade and ‘eliminate’ pathogens or target cells via various mechanisms CLASSICAL Pathway It is based on recognition, complement pathways are classified in to three different types LECTIN pathway ALTERNATIVE Pathway Where are Complement Proteins Produced? LIVER MACROPHAGES • Majority of the complement proteins are produced by liver and macrophages • They are also produced by endothelial/epithelial cells, cells of immune system such as dendritic cells, T- & B- lymphocytes, mast cells and Natural killer cells Target recognition & activation Enzymatic cascade Target elimination COMPLEMENT Antigen-Antibody Pathogen C1q C1r, C1s proteases C1q, a multimeric protein in complex with C1r & C1s proteases (C1-complex) binds antigen-antibody complex Target recognition & activation Enzymatic cascade Target elimination Antibody ‘dependent’ pathway C1q upon binding to a target undergoes a conformational change to activate the associated serine proteases C1r and C1s and this triggers an enzymatic cascade and the classical pathway 1 CLASSICAL Pathway Pathogen Glycans are chains of sugars (also called as oligosaccharides) that decorate cell surface of both pathogens and human cells – but what is the key difference between them? Human cell Mannose sugar at terminal position in microbial glycan Mannose sugar NOT at terminal position in human glycan MBL MBL As a result, pathogen can be recognized by a protein called human mannose-binding lectin (MBL) via recognition of terminal mannose Human cell cannot be recognized by human mannose-binding lectin (MBL) Pathogen Antibody ‘independent’ pathway Lectins along with the partner proteases directly bind to carbohydrate structures on microbial or target cell surfaces; undergo a conformational change to trigger the enzymatic cascade and pathway 2 Mannose present at terminal position MBL Mannose-Binding Lectin (MBL) in complex with MBLassociated serine proteases (MASPs) bind pathogens directly via the terminal mannose sugars on the surface of pathogens MASPs Target recognition & activation Enzymatic cascade Target elimination LECTIN pathway Pathogen C3 H2O Spontaneous hydrolysis of C3 protein generates C3b that binds to –OH or –NH2 groups on pathogens C3 is an abundant complement protein in the serum (~ 1.2 mg/ml) There is constant hydrolysis of C3 in the serum, which in the presence of proteins factor B & properdin generate C3b and trigger the alternative pathway. 3 Target recognition & activation Enzymatic cascade Target elimination C3b ALTERNATIVE Pathway Antibody-Antigen Pathogen C1q C1r, C1s proteases MBL Complement recognizes target cells via multiple ways and accordingly, the pathways are classified; Fill the boxes 1 2 3 MASPs C3 H2O C3b Antibody-Antigen Pathogen C1q C1r, C1s proteases MBL Complement recognizes target cells via multiple ways and accordingly, the pathways are classified 1 2 3 MASPs C3 H2O C3b ALTERNATIVE Pathway CLASSICAL Pathway LECTIN pathway Target recognition & activation Enzymatic cascade Target elimination C3b Pathogen 2. Coats “Eat me signal” 1. “Punches holes” and destroys Pathogen Pathogen 3. “Calls for help” from other cells C3a C5a C3a C5a Target recognition & activation Enzymatic cascade Target elimination 1. “Punches holes” and destroys Pathogen Target recognition & activation Enzymatic cascade Target elimination CLASSICAL pathway as an example Explore more Cytosol Plasma membrane Antigens C4 Antibody C2 C1 C4b C4a Released into blood/extracellular fluid (call for help) C2b C2a C3 convertase C3 C3b C3a C5 C5a C5b C6 C7 C8 Cell leakage and death Poly C9 Membrane Attack Complex (MAC) (C5b-C9) Pathogen The Classical Pathway Cascade CLASSICAL ALTERNATIVE LECTIN The three pathways recognise targets differently, but converge at C3b and follow the same route to eliminate pathogens e.g. via cell lysis Complement killing E. coli Lysed E. coli (Electron microscopy image; Kuby, Immunology, 2003) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3820029/ SELF-DIRECTED LEARNING # 1 W7 Complement_DR GIRIJA • There are five major classes of antibodies. Which ones activate classical pathway of activation? • An antibody has Fc and Fab regions. Which of this region binds to C1q? SELF-DIRECTED LEARNING # 2 W7 Complement_DR GIRIJA You have now learnt that lectin pathway of complement is activated by mannose binding lectin (MBL) and MBL-associated serine proteases (MASPs). MBL recognises mannose on the target cell surface. • Are there any other components/proteins other than MBL that activate lectin pathway? Learn some examples along with what ligands they can recognise https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7408476/ C3b Pathogen 2. Coats “Eat me signal” Target recognition & activation Enzymatic cascade Target elimination Pathogen Macrophages have C3b receptors and bind to C3b (complement fragment) coated on target cells during the enzymatic cascade process What is the “Eat me” signal ? C3b Pathogen C3b C3b Macrophage C3b receptors CLASSICAL LECTIN ALTERNATIVE C3b Coated by any or all of the three pathways Formation of Phagosome Fusion of Phagosome and lysosome to form phagolysosome Macrophage engulfs C3b coated pathogen Lysosomal enzymes degrade the pathogen-complement complex Degraded fragments released as debris from macrophage Complement C3b mediated phagocytosis is very effective in clearing pathogens “Eat me signal” Pathogen 3. “Call for help” from other cells C3a C5a C3a C5a Target recognition & activation Enzymatic cascade Target elimination Signals (phosphorylation) C3b C4b C2a C4b C3d C2a CD19 CD21 B-cell C3d receptor B-cell activation and proliferation Antibody production and Memory cell formation By stimulating antibody production, Complement bridges innate and adaptive immune system. This is vital for mounting a strong and long lasting immune response towards invading pathogens. Complement stimulates Macrophage Neutrophil Basophil Eosinophil Mast cell C3a C5a C3a C5a Call for help from other immune cells Complement activation products such as C3a & C5a act as anaphylatoxins and interact with many other cells of immune system and can cause inflammation Chemotaxis Phagocytosis Cytokine production Degranulation Oxidative burst Learning Objectives Learning Outcomes 1. Complement components & activation • What is complement pathway? • Which cells produce complement proteins? • What are the different types of pathways ? • What are the different target recognition mechanisms? • How do the pathways get activated? • What are the various effector mechanisms and the fate of the target cells? 2. Regulation of Complement • What is Complement Regulation? Why is regulation of complement important? • What are the types of complement regulators? Learn with examples Complement SELF (Do NOT attack) NON SELF (Attack) ALTERED SELF (Attack) What are Regulators of Complement Activation (RCA)? Regulatory proteins bind to various complement components and inhibit their “inappropriate activation” by • destabilizing activation complexes • mediating specific proteolysis of activation-derived fragments Inappropriate complement activation = (a) unnecessary pathway initiation and activation in the serum or extracellular fluid and (b) activation on self-cells DAF MAC-IP MCP Human cell • DAF = Decay Accelerating Factor (dissociates C3 convertase) • MAC-IP = Membrane Attack Complex – Inhibitory Protein (inhibits polymerization of C9) • MCP = Membrane Cofactor of Proteolysis (degrades C4b and C3b) • Pathogens, in general, do not have complement regulators. • Exception: They may adapt to innate immune system and acquire them Membrane bound Regulators of Complement Activation prevent self-attack in a range of ways Soluble Regulators in the plasma or extracellular fluid are recruited on host cell surface to prevent complement self-attack C1 INH Factor I Factor H Protein S SIALIC ACID (N-acetyl Neuraminic acid derivatives) and GLYCOSAMINOGLYCANS of Human Cell facilitate binding of regulators from blood • Difference in the cell surface carbohydrate composition of host versus microbial cells favours the host. • Pathogens generally lack or have significantly lower levels of sialic acid and hence cannot recruit complement regulators, thus susceptible to complement attack Complement Lectures – Summary Complement network provides front line immune defence against pathogens, altered self cells and allergens. Complement can be initiated by Classical, Lectin and the Alternative pathways. They eliminate the targets cells by multiple mechanisms: Lysis, phagocytosis and cell signalling. Human Complement regulation is very important to prevent self-damage. There are a number of membranebound and soluble complement regulators that prevent complement self-damage. Pathogens normally cannot use these human regulatory mechanisms, however there are exceptions. http://www.annualreviews.org/doi/abs/10.1146/annurev-immunol-032713-120154 Complement general review http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4543182/pdf/kjped-58-239.pdf Complement Regulation Recommended books and journal articles: Further reading • Abul K Abbas, Andrew H Lichtman and Shiv Pillai. Cellular and molecular Immunology, Elsevier, 2014, 8 th edition • Owen, Punt and Stranford. Kuby Immunology; Palgrave Macmillian. 2015. 7 th edition. • Peter J. Delves, Seamus J. Martin, Dennis R. Burton and Ivan M. Roitt. ROITT’S ESSENTIAL IMMUNOLOGY; 2011, 12th edition Books Dr Umakhanth Venkatraman GIRIJA umakhanth.venkatramangirija@dmu.ac.uk BIOM2004 Inflammation & Immunobiology Major Histo Compatibility (MHC) or Human Leukocyte Antigen (HLA) Learning Objectives Learning Outcomes 1. Types, Structure and functions • What is MHC? • What are the different types of MHC? • What are the structural features of MHC proteins? • What is the function of MHC and how is it important? • What are polygenic and polymorphic properties of MHC? How are they important? 2. Antigen processing and presentation • Antigen processing and presentation by MHC-I o Expression of MHC-I o Molecular processing and presentation of antigenic peptides • Antigen processing and presentation by MHC-II o Expression of MHC-II o Molecular processing and presentation of antigenic peptides MHC is the process of taking orgaGenetically identical individuals Genetically different individuals Inherited Genes must be involved in the process of transplant rejection Major Histo Compatibility (MHC) Tissue Suitability / matching Inherited Genes must be involved in the process of transplant rejection MHC complex is a collection of genes arrayed within a long stretch of DNA on chromosome 6 in humans MHC is called as Human Leukocyte Antigen (HLA) complex MHC = HLA Chromosome 6 Long arm Short arm MHC Class II MHC Class I • Class I and II have common structural features • Both have roles in antigen presentation Class III • Class III include complement proteins and cytokines • Critical to immune function MHC is of three types: Class I, II and III 2-micro globulin Transmembrane segment Cytoplasmic tail 2 1 3 Membrane-proximal domains (Ig-G like) Membranedistal domains 1 2 1 2 (Peptide)-binding cleft MHC Class I MHC Class II • Ends of peptide binding cleft is CLOSED • Can accommodate only shorter peptides: 8- 11 amino acids • Ends of peptide binding cleft is OPEN • Can accommodate longer peptides: 10-30 amino acids MHC class I MHC class II Arrows indicate closed cleft (MHC-I) and open cleft (MHC-II); Circles drawn to show the peptides which are reddish orange in colour MHC presents both “SELF” and “NON-SELF” peptides MHC displaying “FOREIGN” peptides • To signal immune cells for elimination of pathogens MHC displaying “SELF” peptides • To show the cell is healthy • To maintain tolerance to self-proteins Pathogen Human cell DP DQ DR B A C     1  Polygen • Multiple MHC genes code for same function i.e. display peptides • Each MHC molecule can bind many peptides DP DQ DR B A C     1  DP DQ DR B A C     1  Polymorp• MHC genes are the most polymorphic genes in mammalian genome • As a result, MHC proteins are variable in individuals • >5000 MHC alleles have been estimated so far (polymorphism = occurrence of different forms of same gene among the individuals or population) DP DQ DR B A C     1  MHC Polymorphic Polygenic High degree of variability in the population Fight range of microbial infections MHC – Interesting Research Facts Cheetahs have low MHC diversity MHC – Interesting Research Facts • MHC genes are known to be involved in mate choice in a number of species (e.g. in fish, birds, mammals) • The more MHC variation seems to be preference for pairing • Outcome – species diversity Learning Objectives Learning Outcomes 1. Types, Structure and functions • What is MHC? How was it discovered ? • What are the different types of MHC? • What are the structural features of MHC proteins? • What is the function of MHC and how is it important? • What are polygenic and polymorphic properties of MHC? How are they important? 2. Antigen processing and presentation • Antigen processing and presentation by MHC-I o Expression of MHC-I o Molecular processing and presentation of antigenic peptides • Antigen processing and presentation by MHC-II o Expression of MHC-II o Molecular processing and presentation of antigenic peptides MHC MHC class I MHC Class I expression is found throughout the body • ALMOST ALL NUCLEATED CELLS express MHC Class I • Constitutive expression • Red Blood Cells (RBCs) are non-nucleated and do not express MHC • Lymphocytes express highest levels of MHC Class I • 5 X 105 MHC Class I molecules per lymphocyte • Fibroblasts, muscle cells, liver cells and some neural cells express very low levels of MHC Class I MHC-I Intracellular human proteins (Normal, Cancer) PROTEASOME Short Peptides (Proteasomes are multiprotein enzyme complexes and are involved in Proteolytic degradation of proteins) Viral infections (always intracellular) viral proteins synthesized intracellularly in the host (human) (Chlamydia, Mycobacterium, Neisseria, Salmonella) Some bacterial infections are also intracellular MHC-I How peptides are fo(Endogenous path Transporter associated with Antigen Processing (TAP) Endoplasmic Reticulum Golgi MHC I Displayed MHC I + peptide recognized by cytotoxic T-cell (CD8+) How MHC-I delivers the peptides on cell surface ? (Endogenous Pathway) MHC-I • Proteins degraded by proteasome enter ER via TAP, where they bind to MHC-I • MHC-I + peptide complex is carried by golgi and presented on cell surface • Cytotoxic CD8+ T-cells recognize this complex and via T-cell receptor • CD8+ T-cell proliferates and releases enzymes like perforin, granulozymes which puncture or degrade the entire cell Viral / Intracellular bacteria infected cell / cancer cell has to die (cannot be repaired) MHC-I MHC class II MHC-II Extracellular bacteria or extracellular pathogens Drugs bound to proteins Soluble foreign antigens (allergens) MHC class II presents peptides derived from … MHC Class II expression – restricted to Antigen-Presenting Cells (APCs) Dendritic Cells Macrophages B cells Professional APCs MHC Class II Expression Constitutive Need activation (TLR signalling) Constitutive TLR – Toll Like Receptors are pattern recognition molecules on cell surfaces MHC Class II expression – restricted to Antigen-Presenting Cells (APCs) Non-Professional APCs Fibroblasts (skin) Glial cells (Brain) Pancreatic beta cells Thyroid epithelial cells Vascular endothelial cells • Deputize professional APCs for short periods • When? During sustained inflammation • Require activation for expression of MHC II and costimulatory molecules Lysosomal enzymes degrade bacterial proteins in phagolysosomes Flagella 3 1 Endosome Lysosomes 2 Endoplasmic Reticulum Invariable chain occupies MHC-II binding site temporarily 4 Antigen Presenting Cell Lysosomal enzymes also remove the invariable chain 6 Golgi 5 7 • Free MHC II picks up the processed bacterial peptide • Special vesicular structure delivers the complex on cell surface MHC II + peptide recognized by T-helper cell MHC-II MHC-II: Exogenous pathway – How antigens are recognised, processed and delivered on cell surface? MHC-III • Extracellular antigens internalized by antigen presenting cells via endosomes • Fusion of endosomes and lysosomes allow the lysosomal enzymes degrade the internalized antigens into short peptides. • MHC-class II with the invariant chain is synthesized in ER, but the chain is later removed by lysosomal enzymes. • This allows the free MHC-II to bind to the short peptides, which are then transported to the cell surface via special vesicles. • Displayed MHC-class II + peptide complex is recognized by CD4+ T-cells. T-cells proliferate releasing chemokines and switch on the immune network by stimulating CD8+ cells, B-cells, etc. MHC-I MHC-II Present on all nucleated cells Present only on antigen presenting cells Binds endogenous antigens Binds exogenous antigens Present antigens (short peptides 8-11 amino acids) to CD8+ cytotoxic T-lymphocytes Present antigens (peptides of 11-30 amino acids) to CD4+ helper T-lymphocytes Presence of foreign or over abundant (e.g. cancer) antigens induces cell destruction (and is the only way) Presence of foreign or over abundant (e.g. cancer) antigens induces antibody formation and invites inflammatory cells SELF-DIRECTED LEARNING # 1 W8_MHC_DR GIRIJA Red-Blood Cells (RBC) are non-nucleated and do not express MHC. Platelets also lack nucleus, but do they express MHC? Do platelets express MHC? RBC SELF-DIRECTED LEARNING # 2 W8_MHC_DR GIRIJA We discussed about the mechanisms of antigen presentations by MHC (which is HLA in humans). The below link for research paper could be a very useful source for additional self-directed learning. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5159193/ 1. How can the knowledge be translated in to clinical medicine? What are the potential applications? (as a minimum, read this section of the paper: Concluding remarks and future perspectives) • What is MHC/HLA? What are its functions? • What are the different types of MHC? What are their structural properties? • What is the importance of polymorphic and polygenic features of MHC? • Endogenous pathway: What is the mechanism of antigen processing and presentation by MHC class I. • Exogenous pathway: What is the mechanism of antigen processing and presentation by MHC class II. • Summarise the differences between MHC class I and class II. MHC – Some Sample Questions SELF READING BUILDING ON THE LECTURE CONTENT IS VERY IMPORTANT FOR YOUR LEARNING EXPERIENCE AND ALSO FOR THE EXAMINATIONS Recommended reading • Peter J. Delves, Seamus J. Martin, Dennis R. Burton and Ivan M. Roitt. ROITT’S ESSENTIAL IMMUNOLOGY; 2011, 12th edition • Abul K Abbas, Andrew H Lichtman and Shiv Pillai. Cellular and molecular Immunology, Elsevier, 2014, 8 th edition • Owen, Punt and Stranford. Kuby Immunology; Palgrave Macmillian. 2015. 7 th edition. Books Journal articles https://www.ncbi.nlm.nih.gov/pubmed/27614798 Mucosal Immunity Dr Umakhanth Venkatraman GIRIJA umakhanth.venkatramangirija@dmu.ac.uk BIOM2004 Inflammation & Immunobiology Learning Objectives Learning Outcomes 1. What are the mucosal organs? • Name the major mucosal systems and the organs involved: o Gastrointestinal system o Respiratory system o Urogenital system • What is a mucosal tissue? What does it secrete? 2. Gastrointestinal System 2.a. Different types of cells, secretory products and their antimicrobial nature • Overview of the GI system and Intestinal Epithelial cells • Specialized cells: Goblet cells, Stem cells, Paneth cells – their structure, functions • Antimicrobial secretions: Defensins, Phospholipase and lysozyme – What are they? What are their mode of action? 2.b. Antigen sampling, presentation and maintenance of immune tolerance • What are M-cells? • How antigens are sampled in the GI system and presented to the immune system? What is the outcome? • Importance of Immune homeostasis in the GI system • The role of Treg cells and IL-10 Mucosal Immunity Learning Objectives Learning Outcomes 1. What are the mucosal organs? • Name the major mucosal systems and the organs involved: o Gastrointestinal system o Respiratory system o Urogenital system • What is a mucosal tissue? What does it secrete? 2. Gastrointestinal System 2.a. Different types of cells, secretory products and their antimicrobial nature • Overview of the GI system and Intestinal Epithelial cells • Specialized cells: Goblet cells, Stem cells, Paneth cells – their structure, functions • Antimicrobial secretions: Defensins, Phospholipase and lysozyme – What are they? What are their mode of action? 2.b. Antigen sampling, presentation and maintenance of immune tolerance • What are M-cells? • How antigens are sampled in the GI system and presented to the immune system? What is the outcome? • Importance of Immune homeostasis in the GI system • The role of Treg cells and IL-10 Mucosal Immunity Food antigens (Innocuous/safe) Commensals (Symbiotic microbes) Pathogen Entry & breaching the intestinal barrier Immune System does not react Immune System maintains tolerance Immune System has to defend What are the Mucosal organs / systems? Sinus Trachea Lungs Respiratory Oral cavity Tract Oeso phagus Stomach Gastrointestinal Tract Intestine Bladder Vagina Uterus Urogenita Tract Kidney Mammary glands Lacrymal gland Salivary gland Conjunctiva Immunobiology, Fig 11.1, 7th edition; Garland Science (2008) A range of mechanisms: physical, biochemical and immunological What is Mucosal tissue ? They cover the cavities in the body and also the blood vessels and organs Mucus is a thick slippery jelly like fluid: For example in nose, stomach, urogenital tract A tissue that is able to “secrete mucus” Where? across an epithelial cell layer Contribute to “immune defence” Learning Objectives Learning Outcomes 1. What are the mucosal organs? • Name the major mucosal systems and the organs involved: o Gastrointestinal system o Respiratory system o Urogenital system • What is a mucosal tissue? What does it secrete? 2. Gastrointestinal System 2.a. Different types of cells, secretory products and their antimicrobial nature • Overview of the GI system and Intestinal Epithelial cells • Specialized cells: Goblet cells, Stem cells, Paneth cells – their structure, functions • Antimicrobial secretions: Defensins, Phospholipase and lysozyme – What are they? What are their mode of action? 2.b. Antigen sampling, presentation and maintenance of immune tolerance • What are M-cells? • How antigens are sampled in the GI system and presented to the immune system? What is the outcome? • Importance of Immune homeostasis in the GI system • The role of Treg cells and IL-10 Mucosal Immunity GastrointestinCombined total surface area of small and large bowel is about 40m2 (comparable to a studio apartment) About 1000 different microbial species live in our GI tract and 1014 bacterial cells in our gut; they are commensals or friendly microbes Physical barriers and Secretions Mucus 1 Antimicrobial secretion Connective tissue Muscle tissue Epithelial cell layer Villi 2 Helps in nutrient absorption and also makes it difficult for pathogenic invasion GastrointestinT-lymphocyte B-lymphocyte Macrophage 3 Immune response a. Cellular: MHC class I & II b. Humoral (Ab) response Lymphoid Tissue (Peyer’s patch) GastrointestinIntestinal Epithelial Cells – What is special in them? Epithelial cell Special cells Crypt Lymphoid tissue (Peyer’s patch) Goblet (cup shaped) cells Present in the crypt of the epithelium • Secrete MUCUS • Microbial infection leads to transient excess mucus secretion (within milliseconds) 95% water + 5% Mucins Mucins are heavily glycosylated proteins; Glycosylation gives mucus the viscosity and also protect mucins from protease degradation Mucins bind to microbes and eliminate them 19 different type of mucins MUC US Goblet cells Consistent excess mucus production over weeks or months could be indication of cancer • Paneth cells present in the crypt along with stem cells • Paneth cells functionally similar to neutrophils and secrete a number of antimicrobials • Stem cells have a role in epithelial replenishment Paneth cells Stem cells Paneth and Stem cells Defensins (Antimicrobial peptides) Strongly hydrophobic Positively charged Antimicrobials secreted by Paneth cells Small: 18-45 amino acids • -defensins (secreted by paneth cells and neutrophils) • -defensins (epithelial cells) DNA/RNA functions interfered Cell membrane disrupted & Cell contents leak DNA RNA Cell membrane (-ve charge) Defensin (+ve charge) Microbe How do Defensins work? Lysozyme (Muraminidase) • Binds to N-acetyl muramic acid of bacterial cell wall • Cell wall integrity lost • Kills bacteria Phospholipase A2 • Binds to bacterial cell membranes • Bacterial cellular lysis and death Other Antimicrobials Learning Objectives Learning Outcomes 1. What are the mucosal organs? • Name the major mucosal systems and the organs involved: o Gastrointestinal system o Respiratory system o Urogenital system • What is a mucosal tissue? What does it secrete? 2. Gastrointestinal System 2.a. Different types of cells, secretory products and their antimicrobial nature • Overview of the GI system and Intestinal Epithelial cells • Specialized cells: Goblet cells, Stem cells, Paneth cells – their structure, functions • Antimicrobial secretions: Defensins, Phospholipase and lysozyme – What are they? What are their mode of action? 2.b. Antigen sampling, presentation and maintenance of immune tolerance • What are M-cells? • How antigens are sampled in the GI system and presented to the immune system? What is the outcome? • Importance of Immune homeostasis in the GI system • The role of Treg cells and IL-10 Mucosal Immunity M-cells Specialized epithelial cells (similar to macrophages) Present above organized lymphoid follicles called payer’s patches Have irregular small villi Coated with glycolipids and proteins; help them interact with antigens and microbes Peyer’s patch (Lymphoid tissue) How do M-cells function? Bacteria Antigens ❑ M-cells can uptake antigens as well as whole bacteria by a process similar to phagocytosis ❑ Antigens sampled by professional antigen presenting cells (e.g. Dendritic cells, macrophages) Immune signalling following M-cell Phagocytosis/Pinocytosis/Transcytosis CD4 + Helper T-cell IL-2 IL-2 CD4 + Helper T-cell CD4 + Helper T-cell CD4 + Helper T-cell T-cell proliferation B-cell Pathogens / Infections IL-2 IL-2 B-cell B-cell B-cell proliferation • Antigen presenting cells (Dendritic cells) presenting a pathogenic peptide via MHC-Class II stimulates CD4+ T-cell to secrete IL-2. • IL-2 signal leads to T-cell and B-cell proliferation mounting an immune response against pathogens. • MHC class I presentation will lead to CD8+ cell proliferation (not ideal for the mucosal system, but where essential, this has to happen) Epithelial cell layer Villi GastrointestinaB-cell T-cell Interleukin-10 (IL-10) maintains immune homeostasis TREG IL-10 IL-10 IL-10 IL-10 • Dendritic cells constantly sample antigens by protruding between epithelial cells. • Sampling of commensals or non-pathogenic antigens and presentation to T-cells, render the T-cells to become T-regulatory cells (TREG). • TREG then secrete IL-10 (Interleukin-10) which is anti-inflammatory (stops inflammation). Failure of immune balance / homeostasis leads to inflammatory bowel disease and other intestinal disorders SELF-DIRECTED LEARNING # 1 W11_MUCOSAL IMMUNITY In this week-11 lecture, we briefly discussed about defensins, the types of defensins and how can they defend against microbes. You have also learnt about complement in an earlier lecture. Human Neutrophil Peptide-1, one of the defensins, also interplays with complement. Below paper link would be an useful reading resource. If you do not get access to full paper, at least read the abstract. https://www.ncbi.nlm.nih.gov/pubmed/17448537 1. Which components of complement do defensins interact with? 2. What is the outcome of defensin-complement interaction? Learning Objectives Learning Outcomes 3. Respiratory System 2.a. Lymphoid organs/glands of airways • Importance and the functions of o Nasal Associated Lymphoid Tissue (NALT) o Tonsils o Adenoids 2.b. Epithelial layers of different airways • Common infectious diseases in the respiratory tract • Cells and macromolecules associated with trachea, bronchioles, alveoli • Pulmonary Surfactant: What is the composition? What are Surfactant Proteins? What is their structural architecture? How do they eliminate pathogens? • Respiratory Distress Syndrome 3. Urogenital System Brief overview • Key components that provide immunity: o Antibodies, Antimicrobial peptides, NK cells, Neutrophils 4. Antibody Response in the Mucosal System • Properties of IgA and secretory mechanism into lumen • Class switch recombination: signalling and mechanism Mucosal Immunity Learning Objectives Learning Outcomes 3. Respiratory System 2.a. Lymphoid organs/glands of airways • Importance and the functions of o Nasal Associated Lymphoid Tissue (NALT) o Tonsils o Adenoids 2.b. Epithelial layers of different airways • Common infectious diseases in the respiratory tract • Cells and macromolecules associated with trachea, bronchioles, alveoli • Pulmonary Surfactant: What is the composition? What are Surfactant Proteins? What is their structural architecture? How do they eliminate pathogens? • Respiratory Distress Syndrome 3. Urogenital System Brief overview • Key components that provide immunity: o Antibodies, Antimicrobial peptides, NK cells, Neutrophils 4. Antibody Response in the Mucosal System • Properties of IgA and secretory mechanism into lumen • Class switch recombination: signalling and mechanism Mucosal Immunity • Rhinovirus • Respiratory Syncytial virus (RSV) • Parainfluenza virus • Influenza virus Infectious Respiratory Diseases Upper respiratory tract Examples • Streptococcus pneumoniae • Mycobacterium tuberculosis • Haemophilus influenzae Lower respiratory tract Examples Tonsils Adenoid NALT • Tonsils and Adenoid are small glands • Antigens are directly delivered and processed Nasal Associated Lymphoid Tissue • First lymphoid site that contacts antigens from the environment Lymphoid organs of Airways Tonsils Adenoid Surface area of tonsil crypts is ~300cm2 Maximizes the chances for antigen processing and clearance before pathogens can access respiratory tract Ideally suited to sample antigens entering the airways Learning Objectives Learning Outcomes 3. Respiratory System 2.a. Lymphoid organs/glands of airways • Importance and the functions of o Nasal Associated Lymphoid Tissue (NALT) o Tonsils o Adenoids 2.b. Epithelial layers of different airways • Common infectious diseases in the respiratory tract • Cells and macromolecules associated with trachea, bronchioles, alveoli • Pulmonary Surfactant: What is the composition? What are Surfactant Proteins? What is their structural architecture? How do they eliminate pathogens? • Respiratory Distress Syndrome 3. Urogenital System Brief overview • Key components that provide immunity: o Antibodies, Antimicrobial peptides, NK cells, Neutrophils 4. Antibody Response in the Mucosal System • Properties of IgA and secretory mechanism into lumen • Class switch recombination: signalling and mechanism Mucosal Immunity CLARA cells Bronchiole Small airways Surfactant Trachea GOBLET cells Large airways Cilia SP-A,B,C,D Alveoli Type II cells Type I cells Epithelial layers of different airways SP = Surfactant Protein Pulmonary Surfactant = Phospholipids + Proteins (Surfactant proteins) Pulmonary Surfactant maintains the surface tension in the airways • Hydrophobic peptides • Interact with phospholipids to lower the surface tension within alveolus Surfactant proteins SP-A SP-D SP-B SP-C • Glycoproteins • Immunomodulatory properties N-terminal domain (cysteine rich) Collagen domain Carbohydrate Recognition Domain (CRD) Neck CRD recognizes and binds to • carbohydrate targets (mannose, fucose) on pathogens • DNA, Phospholipid and other protein structures on apoptotic cells X 6 = SP-A (Hexamer) SP-D (Tetramer) Surfactant Proteins SP-A and SP-D are multimeric and recognize a range of ligands SP-A Pathogen Pathogen SP-A (CRD) binds to mannose / fucose moieties on pathogens, undergoes a conformational change to facilitate binding Multiple SP-A and SP-D can bind to the pathogen, cause aggregation and eliminate them by biophysical means (via cough and sputum) Pathogen elimination mechanism – 1 • SP-A and SP-D bind to the pathogens • Macrophages have receptors for SP-A and SP-D, which then present the bound pathogens or antigens for phagocytosis Pathogen Pathogen elimination mechanism – 2 Macrophages with SP-A and SP-D receptors Normal alveoli Both SP-A and SP-D can bind to DNA, exposed proteins or phospholipids of apoptotic cells in the alveolar region and help in their elimination by phagocytosis Apoptotic cells with blebs, exposed cell membrane and DNA SP-A SP-D Alveoli collapse RDS Respiratory Distress Syndrome Lungs Airway Normal alveoli Collapsed alveoli Common in babies born <34 weeks of gestational age develop RDS Lungs have not developed fully enough to produce surfactant (which normally keeps the alveoli open after exhaling) If surfactant is not present, baby has to work hard to reopen alveoli Interesting Research Facts • Spike-protein (also called as S-protein) of Corona virus is recognised by SP-D • SP-D receptors on phagocytes recognise the SP-D bound to Corona virus • Corona virus should be engulfed by the phagocytes Envelope-protein Spike-protein Membrane-protein https://www.frontiersin.org/articles/10.3389/fmed.2020.00254/full Interesting Research Facts https://www.researchgate.net/publication/6410295 Seems easy But the battle is complex Because, Corona virus/cytokine storm can destroy the alveolar cells leading to reduced blood oxygenation, impaired surfactant production including SP-D, fibrosis, oedema and respiratory failure Corona virus Cytokine storm Learning Objectives Learning Outcomes 3. Respiratory System 2.a. Lymphoid organs/glands of airways • Importance and the functions of o Nasal Associated Lymphoid Tissue (NALT) o Tonsils o Adenoids 2.b. Epithelial layers of different airways • Common infectious diseases in the respiratory tract • Cells and macromolecules associated with trachea, bronchioles, alveoli • Pulmonary Surfactant: What is the composition? What are Surfactant Proteins? What is their structural architecture? How do they eliminate pathogens? • Respiratory Distress Syndrome 3. Urogenital System Brief overview • Key components that provide immunity: o Antibodies, Antimicrobial peptides, NK cells, Neutrophils 4. Antibody Response in the Mucosal System • Properties of IgA and secretory mechanism into lumen • Class switch recombination: signalling and mechanism Mucosal Immunity Urogenital Tract • Lacks M-cells • IgG and also IgA dominate the mucosal urogenital tract (while IgA is the dominant in GI and Respiratory tract) • Antimicrobial defensins, lactoferrin, lipcalin and Tamm-horsfall protein (THP) exclusively binds to fimbriae and enhances bacterial washout via urine • Natural Killer Cells and Neutrophils play a major role in pathogen elimination by direct killing Learning Objectives Learning Outcomes 3. Respiratory System 2.a. Lymphoid organs/glands of airways • Importance and the functions of o Nasal Associated Lymphoid Tissue (NALT) o Tonsils o Adenoids 2.b. Epithelial layers of different airways • Common infectious diseases in the respiratory tract • Cells and macromolecules associated with trachea, bronchioles, alveoli • Pulmonary Surfactant: What is the composition? What are Surfactant Proteins? What is their structural architecture? How do they eliminate pathogens? • Respiratory Distress Syndrome 3. Urogenital System Brief overview • Key components that provide immunity: o Antibodies, Antimicrobial peptides, NK cells, Neutrophils 4. Antibody Response in the Mucosal System • Properties of IgA and secretory mechanism into lumen • Class switch recombination: signalling and mechanism Mucosal Immunity Antibody immune response dominates mucosal system 0 20 40 60 80 100 IgGIgG IgA IgAIgM IgMIgE IgDIgE IgD Systemic antibody levels Mucosal antibody levels Relative % IgG IgG IgA IgAIgM IgMIgE IgDIgE IgD IgG is the dominant Ab in Systemic response IgA is the dominant Ab in Mucosal response IgA IgA Resistant to proteases Stable in acidic environments of GI tract Higher affinity to antigens Less inflammatory: good for GI (binds very weakly to complement) Secretory component is antimicrobial J-chain Dimeric IgA Plasma B cells are White Blood Cells (WBCs) secreting large volumes of Antibodies (Ab) Two IgA molecules linked together by a third molecule called the Joining chain (J-chain) 1 2 3 4 Dimeric IgA can bind 4 antigens ! Antigen-IgA complex agglutinates in the lumen (IgA DOES NOT activate COMPLEMENT) Clearance via Peristaltic movement Peristalsis – contraction and relaxation of muscles to pass the food through GI tract and finally the waste Agglutination of antigens and elimination by peristalsis is a better choice than complement activation, because the latter could be more stressful to the system in a mucosal area Dimeric IgA – an effective mucosal antibody Dimeric IgA binds to the poly Ig receptor (secretory component) on epithelial cell and taken up by Endocytosis Epithelial cell Lumen (food pipe) Apical Surface Basolateral Surface Plasma cell in the lymphoid tissue secretes dimeric IgA Dimeric IgA + extracellular domain of poly Ig receptor RELEASED INTO THE LUMEN Naive Plasma-B cells express IgM or IgD IgD IgM In a mucosal immune response, it shifts to IgA How IgA Antibody Class Switching Antibodies Heavy chain Light chain C C C C C C V V V V Ag Ag Constant region Variable region detects different antigens from bacteria, virus, cancer cell and this variability is formed by hyper mutation (VDJ recombination) • Carries out the effector functions by interacting with immune network • This determines the type of antibody e.g. IgM, IgG, IgA, IgD and IgE Class Switching V D J IgM IgD IgG IgE IgA S S S S S S S S V D J IgA Class switch recombination allows the heavy chain gene coding for IgA antibody DNA repair V D J IgA DNA repair AID AID AID AID 2. Upon breakage, the intervening sequences will be lost. VDJ and IgA sequences are then recombined by class switch recombination and DNA repair mechanisms. This leads to secretion of IgA antibody. (this intervening sequence will be lost) 1. Upon receiving the appropriate cytokine signal, Activation Induced cytidine Deaminase makes double strand breaks in S (Switch) regions upstream of IgA and IgM T-cell B-cell Pathogen GammaInterferon Y IgG IL-4 TGF-Beta Y YIgA IgE • B-cell normally makes IgM and IgD antibodies. Upon receiving an appropriate cytokine signal (which depends on the type of Tcell), B-cell switches to form a different class of antibody (the above list only contains example cytokines). This is called Antibody Switching. • B-cell then transforms into plasma cell and a plasma blast produces enormous number of the specific antibody T-Helper cell 1 T-Helper cell 2 T-regulatory cells Depending on the pathogen and site of infection Summary Gastro intestinal, respiratory and uro-genital tracts form the major components of mucosal systems in our body. Physical barriers (villi, M-cells, goblet cells) and antimicrobial secretions (defensins, lysozyme, phospholipase) try to maintain the ever active GI tract free of infections. T-regulatory cells help to maintain immune tolerance via IL-10 secretion. This helps the mucosal immune system to stop constant inflammatory response in the GI tract. Mucosal Immunity Summary While cell mediated immune response has a role to play in mucosal immune defence, it is the humoral (antibody) mediated response which dominates. IgA is the dominant antibody in GI and respiratory tract, while both IgG and IgA dominate the urogenital tract. Epithelial cells of mucosal system comprise many special cells which secrete antimicrobials that help in fighting infections. Antibody class switching is the mechanism used by B-cells to produce IgA in the mucosal surface which transfer to the lumen by endocytosis. Mucosal Immunity • What are the various mucosal organs in our body? Mucosal Immunity (part-1) – some sample questions 1. Mucosal organs/systems 2. Physical barriers and Secretions 3. Antigen sampling and immune response 4. Maintenance of immune tolerance • What are goblet cells and stem cells in the mucosal lining? • What is mucus? Outline how it provides defence against pathogens. • What are Paneth cells? What is their role in mucosal immunity? • Describe the various antimicrobial secretions that support our immune system in the gastro intestinal system. • Describe the role of M-cells in antigen sampling and explain the fate of such antigens. • Explain how immune homeostasis or tolerance is maintained in the gastro intestinal system. Mucosal Immunity (part-2) – Practice questions • What features of IgA make it an ideal antibody in mucosal immunity? • Explain the mechanism of transfer of IgA across the epithelial surface. • What is Antibody Class Switching? What are the major cytokine signals that mediate antibody class switching? Antibody response in the mucosa Immune response in Respiratory tract Immune response in Urogenital tract • What are the major structural features and their associated immunological role in the respiratory tract ? • What is the composition of Pulmonary surfactant? • What are the different types of Surfactant proteins? Explain their role in airway immunity. • What is Respiratory Distress Syndrome. Why is it caused? • What are the major immunological features of urogenital system? Reading • Peter J. Delves, Seamus J. Martin, Dennis R. Burton and Ivan M. Roitt. ROITT’S ESSENTIAL IMMUNOLOGY; 2011, 12th edition • Abul K Abbas, Andrew H Lichtman and Shiv Pillai. Cellular and molecular Immunology, Elsevier, 2014, 8 th edition • Owen, Punt and Stranford. Kuby Immunology; Palgrave Macmillian. 2015. 7 th edition. Books

One Danish survey by Gunther Eysenbach (2007) found that the online survey received a 6% higher response rate than its classic paper counterpart. I completely agree with the thesis that online surveys are an effective form of gathering data from the target group.

Assumptions that online surveys can significantly compete and even outclass their paper counterparts. Although pencil surveys probably always will be an emergency solution according to Carlos Mendes (2018). in In this essay, I will mainly consider the workload that the researcher spends on preparing the survey and the potential benefits. Arguments such as conversion from a survey, calculated by the respondent’s response rate, are paramount. Time and subsidized measures are important factor. The researchers (Kenny, 2005) & (Burdock, 2005) in their works came to the same conclusion that online surveys are characterized by a significantly lower cost of obtaining respondents’ answers than their paper versions. (Barker cited in J. McDonald 2015) stated that the use of online surveys in large-scale quantitative research is an alternative. However, he pointed out that it is worth securing research using two simultaneously available methods, giving the respondents a choice of suitable forms. Also (Burdock, cited in Eysenbach 2007), pointed to the rightness of choosing online surveys as those that reduce the cost of conducted research. Time act a critical role in many studies. Three scientists C. Mendes (2018) & Jim McDonald and Claudia Richardson (2015) agree that online surveys are ahead of paper surveys when it comes to getting respondents’ answers. Surveys published via a link sent by e-mail or published on social networking sites receive immediate results. Speed, flexibility, and accessibility of online surveys is certainly their greatest advantage. There are many more positives Carlos Mendes (2018) articulated that immediate and pre-analyzed results obtained in real-time, obtained thanks to specialized software, make online surveys superior to paper surveys.

Jedno z dunskich badań ankietowych przeprowadzonych przez Gunther Eysenbach (2007), wykazało iż ankieta online uzyskała o 6% wyższy odsetek odpowiedzi niż jej klasyczny papierowy odpowiednik. Całkowicie zgadzam się z tezą iż ankiety przeprowadzone online odznaczają się wysoką skutecznością w porównianiu do ich protoplastów.

W pierwszej kolejności skupmy się na walidacji założen że ankiety online mogą w sposób znaczący konkurować a nawet deklasować ich papierowe odpowiedniki. W tym eseju w głównej mierze będę brał pod uwagę nakład pracy jaki badacz wydatkuje na przygotowanie ankiety oraz potencjalne benefity. Argumenty takie jak konwersja z ankiety liczona współczynnikiem odpowiedzi respondentów jest wartością nadrzędną. Istotnym współczynnikiem jest czas oraz subsydiowane środki.

Zacznijmy od argumentu księgowego jakim są pieniądze.

‘In the modern era, online questionnaires are much more effective than the traditional paper versions. To what extent do you agree with this statement?
According to Gunther Eysenbach (2007), One of the Danish surveys reveal 6% higher response rate in online surveys versus classic paper-pen questionnaires. Online survayes can be beneficial both for paricipants and those who conduct research. I completely agree with formulated statement. Aim of article is to convince reader that online questionaries are more effective compare to old fassion paper questionaries.

Before we move to meritum it must be stated clearly that both online and classic surveys screening methods are almost the same. The main difference is a channel of communication, the way how the survey dish is served. Online surveys usually, do home delivery. With the classic one, we send a survey by post injecting trojan horses into participant’s mailbox. Moreover, we try to force him to participant in our dirty experiment, and if we succeed… Then, our victim will even pay for post stamp just to send us our highly desirable results. Sound ridiculous? Let’s pull out all of the advantages of online questionaries and rebut old fashion paper ones. In pandemic reality we can forget about other forms of screening. We are forced to use online questionaries. Govermenant accuse us for biotherrorism just becouse we did not wear face mask

Firstly let’s consider the most valuable resources like time and costs. (Kenny, 2005) & (Burdock, 2005) pointed out that online survey questionaries reveal that virtual surveys have significantly lower costs per gather data. Barker, 2013 claimed that resign from paper questionnaires is temptation for researches however both type of questionary may be used if there is reason to do it. Timing play important role for success in any kind of research. Execute research project on social media platforms and mail may be done in minutes versus days in classic paper questionarriess. Gathering data and valuating answers in real time is beneficial and more convince than waiting for participants answers. . C. Mendes (2018) & Jim McDonald and Claudia Richardson (2015). In current COVID-19 reality option of executing classic type survey may be questionableThose data can be processed in real time by software and present clear results Carlos Mendes (2018). Lack of those tools and necessity to gather it is main disadvantage of paper based questionnaires.

Identify the target audience preferences and limitation are crucial to chosse appropiate questionary formula. There are two most popular options online questionaris and other one classic pencil-paper survays. The last metode seems to be extint spoon

questionnaires but the opposite has also been reported (Pavlov & Kane, 2006).

Target audience and delivery methode should be first concern what type of survey to choose. However designing questionary in p

Online questionary can
both for participents and for researches. The most

Unormous benefict both for participents and researches indicate on beneficial role

Web-based questionnaires have been shown to lower data collection costs (Burdock, 2005)

Carlos Mendes (2018)
Expanding role of internet change the methods how we can gather data from our participants.

Carlos Mendes (2018) pointed out that we should consider the paper survey questionery for people visually impaired. In some cases it may be a solution. The facts are that well prepared online survey can resolve this issue. Text to speech systems are wide available and can be adopted to read out all of the survey content even our participant is blind. Paper have tendency to keep silent. Computer or smartphone can read laud the content and help with navigation. Carlos Mendes (2018) insinuate that for vision impaired people physical questionary may be better solution. Common sense tell us that we should chose the tools appropriate to our sample group. Almost each today computer offer “high contrast option” or “invert option” in order to maxymalise reading. Also the font can be zoom without any effort providing even single word on our screen. Metioned previously ‘text to speech’ metodes are common tools for people visually impaired or blind. Paper have no ability to scale the font electronic devices do. If we have participant impaired in this kind of way we should provide different communication channel telephonic survey. Idea that we can prepared better questionary for visual impaired person and those kind of questionery can be better than survey prepared seems to be disscusable. Role of researcher should be gather data and overcome any potential obstacles participant can face. For visually impaired person appropriate metode is to provide audiotory aid like a part of classic survey.
Dissadvantyges of paper based survey for researches are profound. Answers on papers sheet may be not easy to read. Therefore survey processing time may harass final results. Open ended question are valuable source of information under condition that we can read it. Results usually are input to spread scheet.

Online survey provide list of multiple tracable benefits both for researcher and for participents.

Paper survey have their benefits in the case when the researcher was granted by government subvention.
Carfull planning is vital important for success of any reasarch

Gathering data can be
Conducting paper survey is almost not possible in pandemic culture. Finding sample group of our participents and get their contact data according to British law is almost not possible for non-profit researcher. Compliaing with Data Protection Act and understanding issues associated with purchasing desire database is multilevel process.

Con
. For example, as Halestorm (2012) identifies, if one is conducting research on patients in assisted living facilities with a target population of seniors with little to no access to computers, paper surveys are necessary. Additionally, respondents in rural, remote locations may have online accessibility issues. In short, examine your target population carefully.

The response rates in most studies so far, however, have been reported to be lower in Web-based questionnaires than in paper-based questionnaires (Kenny, 2005),

Researcher should find the most beneficial method allowing to gather the data from participants. In modern time increasing role of conducting surveys online. Online surveys can be beneficial in many ways compere to classic paper questionaries. The most obvious advantages for researchers is efficiency in gathering data and ease with analysis. Some of online scripts have prebuild futures help to present survey result without any additional afford. Online questionaries can have interactive form and may contain audiovisual aid to engage participant. Rapid distribution and ease with reaching target group is undeniable advantegous of online research. Halestorm (2012) claim the main argument against conducting research online versus classic paper is limited access to internet. However, in 2021 most of people are coveraged by mobile network smartphones become popular and each person can answer on survey if they will to. Quantity of people IT impaired will systematicly decrease even in seniors demographic group. (Barker, 2013)
Online survays provide real time tools not available in paper form Kenny, 2005) ha

Too sumarise. Online survayes have numerous advantyges both for researchers and participents. Environmental issues definitely favor online survays thus they do not requaied paper and avoid unnessesery waste. Access to internet smartphones and computers constant spread. Intergenerational tendency to use technology from early childhood is not a trend is a fact. Conceptions like satellite internet is not longer Sciance Fiction screenplay those satelites already fly over our heads. Halestorm (2012) pointed out that lack access to internet in rural areas should be consider as a threat for online survays. This statement expired like many other ideas in our internet reality. Under those circumstances owever young adolescence may one day learn from history books what was paper never holding even scrap of this material in hand.

(Pavlov & Kane, 2006) argue that mixed-types both online and classic survey can be adopt in some of cases.
Pre analysis of data

Relative ease with distribution and reaching target group is main benefit of online survays. There are no limitation to prepare the same kind of survey both online and in classic form.
Carlos Mendes (2018)

There are not common agreement what type of survay can provide better
There are many counterarguments

Each method have their futures and limitations. The most obvious one is that we can not

Introduction.
Survay

Text 1 – Carlos Mendes (2018) Research Methods for Under-Graduate Students, p.69

When the concept of speed is considered, paper surveys are notorious for taking a good amount of time to execute. Whether administration is in-person, mailed, or sent as an email attachment, speed is always going to be a factor. Time for the respondent to complete the survey and time to mail it back is going to increase the time needed to complete the survey research process. Online Surveys, however, can collect data in very little time. With many online survey software solutions, creating these is simple and can be administered to your population via email or social media networks within minutes. Due to this rapid distribution, your sample population can respond almost immediately, and data is collected automatically. Online survey software also has more advanced logic features that are not available in paper surveys and in this way, allow much more flexibility. Although paper-based surveys certainly still have their place in survey research, and always will, continued advances in technology may increasingly diminish that demand.

Text 2 – Jim McDonald and Claudia Richardson (2015) A Mixed Model Approach, p.22

While there are many issues to consider when planning a quantitative research project, the needs of the population should be the main consideration. The target participants may prefer just online surveys or just paper surveys, and sometimes there may be a need for a mixed-mode for a diverse population (Barker, 2013). This means both paper and online surveys for the same survey research project. The appeal of saving money with online surveys is tempting, but if that survey is not reaching a target audience that prefers a paper survey, the researcher many be wasting their time and efforts. Non-tech savvy respondents may not have access to a computer and therefore not have access to the Internet to complete an online survey via email or on social media networks. For example, as Halestorm (2012) identifies, if one is conducting research on patients in assisted living facilities with a target population of seniors with little to no access to computers, paper surveys are necessary. Additionally, respondents in rural, remote locations may have online accessibility issues.
Text 3 – Gunther Eysenbach (2007) Web-Based Versus Traditional Paper Questionnaires, p.1

Web-based questionnaires have been shown to lower data collection costs (Burdock, 2005), which is attractive especially in large population-based surveys. The response rates in most studies so far, however, have been reported to be lower in Web-based questionnaires than in paper-based questionnaires (Kenny, 2005), but the opposite has also been reported (Pavlov & Kane, 2006). In a questionnaire survey on patients’ experiences with cancer care, no significant difference was observed between the response rates of a mailed paper questionnaire only (64.0%) and those of an online questionnaire followed by a paper reminder (60.5%). A Danish questionnaire survey reported a statistically significantly higher total response rate in a paper-and-pencil group (76.5%) than in a group with access to the questionnaire via log-on to the Internet (64.2%). A study comparing mixed-mode (paper or online) and Web-based questionnaires exploring fertility issues among female childhood cancer survivors found a 6% higher participation rate in the Web-based mode (89%) than in the mixed mode (83%).
**

same. The main difference is a channel of communication, the way how the survey dish is served. Online surveys usually, do home delivery. With the classic one, we send a survey by post injecting trojan horses into participant’s mailbox. Moreover, we try to force him to participant in our dirty experiment, and if we succeed… Then, our victim will even pay for post stamp just to send us our highly desirable results. Sound ridiculous? Let’s pull out all of the advantages of online questionaries and rebut old fashion paper ones. In pandemic reality we can forget about other forms of screening. We are forced to use online questionaries. Govermenant accuse us for biotherrorism just becouse we did not wear face mask

One Danish survey by Gunther Eysenbach (2007) found that the online survey received a 6% higher response rate than its classic paper counterpart. I completely agree with the thesis that online surveys are highly effective compared to their ancestors.

First, let’s focus on validating the assumptions that online surveys can significantly compete and even outclass their paper counterparts. In this essay, I will mainly consider the workload that the researcher spends on preparing the survey and the potential benefits. Arguments such as conversion from a survey, calculated by the respondent’s response rate, are paramount. Time and subsidized measures are an important factor. The researchers (Kenny, 2005) & (Burdock, 2005) in their works came to the same conclusion that online surveys are characterized by a significantly lower cost of obtaining respondents’ data than their paper versions. Barker, 2013 cited in J. McDonald (2015) stated that the use of online surveys in large-scale quantitative research is a significant alternative, however, it is worth securing research using two simultaneously available methods, giving the respondents a choice of a suitable form. Also (Burdock, 2005), quoted in Gunther Eysenbach (2007), pointed to the rightness of choosing online surveys as those that reduce the cost of conducted research.

Jedno z dunskich badań ankietowych przeprowadzonych przez Gunther Eysenbach (2007), wykazało iż ankieta online uzyskała o 6% wyższy odsetek odpowiedzi niż jej klasyczny papierowy odpowiednik. Całkowicie zgadzam się z tezą iż ankiety przeprowadzone online odznaczają się wysoką skutecznością w porównianiu do ich protoplastów.

W pierwszej kolejności skupmy się na walidacji założen że ankiety online mogą w sposób znaczący konkurować a nawet deklasować ich papierowe odpowiedniki. W tym eseju w głównej mierze będę brał pod uwagę nakład pracy jaki badacz wydatkuje na przygotowanie ankiety oraz potencjalne benefity. Argumenty takie jak konwersja z ankiety liczona współczynnikiem odpowiedzi respondentów jest wartością nadrzędną. Istotnym współczynnikiem jest czas oraz subsydiowane środki. Badacze (Kenny, 2005) & (Burdock, 2005) w swoich pracach doszli do tożsamej konkluzji iż ankiety online odznaczają się znacząco niższym kosztem pozyskania danych respondentów niż ich papierowe wersje. Barker, 2013 cited in J. McDonald (2015) określił że użycie ankiet online w szeroko zakrojonych badaniach ilościowch jest istotną alternatywą jednakże asekuracyjnie warto zabezpieczyć badania za pomocą dwóch symultanicznie dostępnych metod dając osobom badanym wybór dogodnej formy. Także (Burdock, 2005) cytowany w Gunther Eysenbach (2007) wskazał na słuszność wyboru ankiet online jako tychy które obniżają koszty przeprowadzonych badan. Czas w wielu badaniach odgrywa krytyczną rolę. Trójka naukowców C. Mendes (2018) & Jim McDonald and Claudia Richardson (2015) jest zgodna co do tego iż internetowe ankiety wyprzedzają ich papierowe wersje w zakresie uzyskiwania odpowiedzi respondentów. Ankiety opublikowane za pomocą linka wysłane mailem lub też opublikowane na stronach portali społecznościowych otrzymują natychmiastowe wyniki. Szybkość, elastyczność, oraz docieralność ankiet internetowych jest z pewnością ich największym zaletą. Pozytwów jest znacznie więcej Carlos Mendes (2018) wyartykułował iż natychmiastowe i preanalizowane wyniki otrzymywane w czasie rzeczywistym otrzymywane dzięki wyspecjalizowanyemu oprogramowaniu stanowią o wyższości ankiet online nad papierowymi.

One Danish survey by Gunther Eysenbach (2007) found that the online survey received a 6% higher response rate than its classic paper counterpart. I completely agree with the thesis that online surveys are highly effective compared to their ancestors.

First, let’s focus on validating the assumptions that online surveys can significantly compete and even outclass their paper counterparts. In this essay, I will mainly consider the workload that the researcher spends on preparing the survey and the potential benefits. Arguments such as conversion from a survey, calculated by the respondent’s response rate, are paramount. Time and subsidized measures are an important factor. The researchers (Kenny, 2005) & (Burdock, 2005) in their works came to the same conclusion that online surveys are characterized by a significantly lower cost of obtaining respondents’ data than their paper versions. Barker, 2013 cited in J. McDonald (2015) stated that the use of online surveys in large-scale quantitative research is a significant alternative, however, it is worth securing research using two simultaneously available methods, giving the respondents a choice of a suitable form. Also (Burdock, 2005), quoted in Gunther Eysenbach (2007), pointed to the rightness of choosing online surveys as those that reduce the cost of conducted research. Time plays a critical role in many studies. Three scientists C. Mendes (2018) & Jim McDonald and Claudia Richardson (2015) agree that online surveys are ahead of paper surveys when it comes to getting respondents’ answers. Surveys published via a link sent by e-mail or published on social networking sites receive immediate results. Speed, flexibility and accessibility of online surveys is certainly their greatest advantage. There are many more positives Carlos Mendes (2018) articulated that immediate and preanalyzed results obtained in real time, obtained thanks to specialized software, make online surveys superior to paper surveys.

Research is the process of design and conduct analysis to validate claims. The most popular Oxford English Dictionary defines the word in the context of gathering information from participants like a series of questions. Although the short explanation does not explore wider context it how complexity influences that word. Questionaries are structured to obtain quantitative and qualitative results (Creswell, 2008). Zegret et al. (2016) pointed out that those documents may have different purposes and goals. Research activities are associated with university faculties; business & social science according to (Dingle, 2019). Expanding role of the internet become a threat for classic paper questionaries. However, each method has their futures. Part of each research is investigation ideas making observations validating novel theories and concepts. The process of study research itself is named meta-research. Research is the wide interdisciplinary conception of validating scientific claims.

According to McCoy (2016), 97% of students use their devices during lectures for other purposes than learning. The aim of the essay is to summarize recorded lecture about digital distractions and provide an overview for those individuals who are affected. Access to digital devices with access to the internet is common. The boon of technology does have a significant negative impact on those who are not conscious of how addictive it can be. Students provide multiple excuses to explain why the device is essential. However, the real issue is not allocated in devices rather in the way how we interact with them. Cure can be administered only if addicted students understand the process of susceptibility. Therefore, behavior can be corrected. Digital distraction can be managed but the consciousness of existing hidden influence. It is the first step to find and organize an action plan in order to find a satisfactory solution. Distracted students have multiple excuses to interact with the screen rather than focus on lectures. The obvious argumentation is that they must stay connected. Despite student reasons, facts indicate to obsessive-compulsive importunity. Unconscious addiction is the main coefficient of behavior. Difficulty to focus attention during lectures is the result of constant usages of technology. Goleman pointed out that skill to focus is even more important than a high IQ. The ability to focus can predict and determine academic success. Use smartphones during lectures is a common behavior. The myth of multitasking is a legend for that student who rationalizes smartphone usage during lectures. The ability to multitasking is impossible for human entities. However, multitasking is partially true. We can focus our attention on one activity then swap to other. Self-regulating techniques are the first step to increase focus and decrease distractions. Distraction management should be a procedure worth consideration. The easiest solution to avoid digital distraction is removing the cause. Furthermore, it can be difficult. Notification interruption is just to turn it off Mavridi (2018). If students must have their smartphone the airplane function may be a wise solution.

Then appropriate plan may be self-administrated. Moreover, additional aid may be necessary to increase the chances of avoiding distractions. Good advice is the procedure of deactivation of all notifications on our devices during the learning process. Removal of temptation is crucial. Creating barriers remove stimulus will decrease the chance of pick up smartphones compulsively.

In conclusion, the constant development of technology is a cause of new previously unknown intrusion habits. Self-regulating techniques may provide recognition of potentially harmful behaviors. Realizing the potential harmfulness of using technology is the first step in turning negative habits into conscious self-regulating activities. Adopting unwritten cultural digital norms of netiquette is compulsory for those who aspire to academic careers. Previously unknown, digital courtesy rituals seem to be a new age savoir vivre.

References:

McCoy, B. (2016) Digital Distractions in the Classroom: Student Classroom Use of Digital Devices for Non-Class Related Purposes, Faculty publications, College of Journalism & Mass Communications. Paper 90, (Accessed: 11.05.2021).

Mavridi, S. (2018) ‘Managing digital distractions in class and beyond’ [Recorded lecture]. LIPCF133_2021_503: Study Skills 3. De Montfort University. 10 April. Available at resource: URL (Accessed: 11.05.2021).

---

ASSIGNMENT CHECKLIST
Please attach a copy of this checklist to your assignment

Module: STUDY SKILLS 3: COMMUNICATION SKILLS (TERM 3)
Module code: LIPCF133_2021_503
Assignment: LECTURE SUMMARY 2; Write a summary based on the lecture notes that you took during the guest lecture – ‘Managing digital distractions in class and beyond’.

Task Requirements
I have completed this cover sheet and checklist and attached it to my essay.
I have checked the brief carefully to ensure I have followed all the instructions.
I have followed the correct formatting guidelines (see brief).
I have NOT used any language generating software, such as Grammarly.
I have written between 450 and 550 words.

Content
My introduction identifies the aims of the lecture and the main points covered.
The main body summarises the content of the lecture.
I have not included any minor details from the lecture, or any information that was not part of the lecture.

Referencing and Paraphrasing
I have referenced all sources, including the lecture itself, both in-text and in a reference list.
I have checked that my referencing style matches the Cite Them Right Harvard referencing guide (available on Blackboard, in the Academic Referencing folder).
I have paraphrased language from the lecturer’s Powerpoint slides and speech.

Writing style
I have checked my work for any errors with academic style.
I have checked my work for grammar and vocabulary errors.

Synthesis analysis and purification of paracetamol.

Reagents

Table no. 1 Reagents list:
4-aminophenol (g)	2.20
Acetic anhydride (ml)	2.20
Propanone (acetone) (ml)	20.00
Commercial paracetamol, 2 tablets (g)	3.43
Ethyl acetate C4H8O2	10
Petroleum ether (ml)	1

Aims

The aim of the experiment is to synthesize paracetamol in the control laboratory environment. Purification, Recrystallization, and comparison of synthesized sample to commercial brand paracetamol. Confirming of obtained substance by assessing melting point. Verification of purity based on Thin Layer Chromatography TLC. Reaffirmation that samples contain paracetamol will be conducted by Infra-Red spectroscopy IR. To validate results three different assay techniques were adopted. IR spectra. TLC paper chromatography. The range of melting point was observed. The purity of the product is confirmed by melting point and by comparison to industry literature.

The reaction of 4-aminophenol with acetyl anhydride is conducted the final product will include paracetamol and acetic acid. The reaction is divide into two main steps the first one is addition second elimination. The amide bond is formed in paracetamol and the by-product ethanoic acid.

Results

The exact mass of 4-aminophenol used as reagent equal 2.20g

Mass of recrystallized purified paracetamol equal 0.82g

Reaction

Graphic no. 1

C₆H₇NO + C₄H₆O₃ = C₈H₉NO₂ + CH₃COOH

4-Aminophenol acetic anhydride paracetamol acetic acid

Ratio 4-aminophenol to acetic anhydride is 1:1

Weight of 4-Aminophenol used to reaction equal 2,20g.

Molar mass of 4-Aminophenol equal 109.128 g/mol.

n(C₆H₇NO)= 0.0202 mol

Volume of acetic anhydride equal 2.2ml

Volume of acetic anhydride = 0,0022dm³

Density of acetic anhydride = 1,08g/ml

Molar mass of acetic anhydride equal 102.089 g/mol.

Mass=Volume*Density

mass(C₄H₆O₃)= 2.2ml *1,08g/ml

mass(C₄H₆O₃)= 2,376g

n(C₄H₆O₃)= 0.0233 mol

C₆H₇NO : C₄H₆O₃

Ratio 1:1

0.0202mol : 0.0233mol

4-Aminophenol is a limiting reagent Thus, has lower moles compare to acetic anhydride.

Acetic anhydride is an excess reagent.

Theoretical and actual yield calculations evaluation is based on limiting reagent. In this case, the limiting reagent is 4-Aminophenol observing the reaction it is concluded that the ratio 4-Aminophenol to paracetamol is 1:1 Therefore, n(4-Aminophenol) =n(paracetamol).

Theoretical Yield for paracetamol

Acetaminophen molar mass = 151.165 g/mol

Theoretical Yield = moles of acetaminophen * molar mass of acetaminophen

                         = 0.0202mol x 151.165/mol

                         = 3,0535 g

Actual yield of paracetamol = 0,82g

Actual Yield obtained in experiment.

Actual Percent Yield =          Actual Yield        x 100%

                             Theoretical Yield

                     =            0,82 g      x 100 %

                                  3,0535g

                     =  26,85 %

Atom economy (Atom utilization)

atom economy =     (Relative formula mass of paracetamol) _* 100%

                             (Sum of relative formula masses of reactants)

atom economy =    (paracetamol) _* 100%

                             Mr(4-Aminophenol)+ Mr(acetic anhydride)

atom economy =    151.165 _* 100%

                             109.128 + 102.089

atom economy =    151.165 _* 100%

  109.128 + 102.089

atom economy =    71,56 %

Melting point

Sample of synthesized paracetamol was observed through the melting process, first visible liquid drop starts at 170°C and finishes at 179°C. Commercial paracetamol start melts at 176°C and finalized at 179°C.

The matching range of substance melting points may be used as a purity indicator. Comparison melting points to scientific articles is a way to ensure the purity of the synthesized substances. Contaminations or impurities in the sample will lower the melting point. Impurities in the sample will lead to extending the range when solid will change the state of aggregation to liquid. Based on this indicator experiment reveal that synthesized paracetamol contains undesired contamination. However, Bashpa et al. (2014) pointed out that the pure paracetamol melting point is 169°C. Conducted examination of 11 brands of paracetamol tablets fit in and coincide with the experimentally obtained melting results.

(IR) Infra-Red Spectrograph

Paracetamol’s bonds interfere with the infrared light spectrum. IR sensors detect the energies of compound bonds. Analysis of obtained data aid to determine the type of bonds in the molecule Therefore, functional groups are marked as present in the molecule. IR spectrogram no. 1 represent reference spectrogram for pure paracetamol. The second chart reveals spectra for commercial brand tablets. The third one shows sample obtain in the laboratory. Visual investigation of charts leads to the conclusion that all examined samples contain paracetamol. Furthermore, Table no. 3 provides pieces of evidence for characteristic peaks and stretches.

Table no. 3 IR Spectrogram
IR spectrum Wavenumbers(cm-1)	Functional group deduced.
3319	N-H
3300	O-H
1650	C=O
1504	C-C (aromatic)
1434	C-C
3090	C-H
1600	C=C

The presence of all these peaks leads to the conclusion that the obtained product is paracetamol. In addition, excellent similarities are clearly notable.

TLC Chromatography

Data gathered from Chromatogram no. 1 was used to calculate the Rf value. Synthesized paracetamol and its commercial brand equivalent are equal and have Rf = 0,44. No additional spots on their bar chart indicate about potentially high purity of both substances. Interesting results three different spots were observed for acetic anhydride. However, those contaminations may be the result of hydrolysis of acetic anhydride. Although, recrystallization of paracetamol and the purification process was conducted appropriately for both paracetamol samples.

Type of substance	Distance traveled in cm	Distance to solventfrontDistance to solvent front in cm	Rf Value
4-aminophenol C6H7NO	3,5	6,4	0,54
acetic anhydride	2,4 / 3,5 / 5,6	6,4	0,37 / 0,54 / 0,87
synthesized paracetamol	2,8	6,4	0,44
commercial brand paracetamol.	2,8	6,4	0,44

Analysis

Hand draw no. 1 present reaction and explanation of processes of addition & elimination in the aqueous solution of acetic anhydride and 4-aminophenol. The explanation why reaction required heat to occurs. Srabovic et. al. (2017) pointed out about solubility of 4-aminophenol in cold water. To obtain high yield solution is heated to approximately 90 degrees of C. 4-aminophenol dissolve successfully in water. Skip the step of heating solution will decrease the yield of paracetamol. Potential reagents contaminations and impurities dissolved in water. In process of the cooling solution when paracetamol crystals start to form significant numbers of contaminations stay in liquid. Therefore, the crystal form of the final product is purified & highly desirable. After the heating solution was cooled. The suspension was filtered by vacuum. Finally, the residue was flushed by cold water and left until water vaporized. Mass of paracetamol crystals was noted. To eliminate all residue contaminations the process of recrystallization was adopted. According to Srabovic et. al. (2017), paracetamol is insoluble in cold water. The mixture was heated and paracetamol dissolve. The solution was cooled down until reach room temperature. Cold paracetamol starts to crystallize. Vacuum flow and paper filter aid help to finish the process. The mass of paracetamol was noticed.

Errors

Each experiment is prone to external environmental conditions. Moreover, those conditions may negatively impact experiment accuracy and to final results obtained. On the first plan, hygroscopic properties of acetic anhydride should be considered. According to Chromatogram no.1 is visible that there are three different spots marked. Water presented in air interreact with acetic anhydride and therefore acetic anhydride hydrolyze. (CH3CO)2O + H2O → 2 CH3CO2H Concentration of acetic anhydride may be a matter of discussion. Acetic anhydride dissolves in water to approximately 2.6% of the mass. Each operation with liquid is prone to misreading burette and for incorrect addition of volume. It must be noticed that process of vacuuming starts rapidly. Uncounted mass of substance was lost in a process. Manifold with digital pressure valve to control airflow should be beneficial and will avoid further disappointment. It is recommended to wet paper filters to get a better grip between vacuumed substance and patch potential air leaks around. In general filtration, suction, as well as lack of researcher experience are major causes of errors.

Recommendations and suggestions

-accuracy and precision with weighting measuring and moving product.

-the slower process of crystallization

-decrease the volume of solvent required to wash residue to a minimum

-decrease the suction in vacuum pump

Conclusion

To conclude all of the mentioned pieces of evidence lead to formulating a statement that the synthesized product is definitely paracetamol. Determined melting ranges were matched to literature. IR spectrogram’s and TLC chromatogram’s results confirmed that the gathered product is paracetamol. Relatively low yield gathered 26.85%. High purity was gained despite the potential contamination of excess reagent. Purity and structure of molecule proven by three assay techniques simultaneously. TLC chromatograph does not show impurities in samples. The melting point for both samples of paracetamol is comparable with professional chemistry literature. IR spectra for both samples of paracetamol matched perfectly according to the paramount pure paracetamol source chart model obtained from IR device. Comparison to literature Bashpa et al. (2014), 11 commercial brands of paracetamol obtained similar melting points. To consideration should be taken the relatively too fast process of paracetamol crystallization. Extend the period of crystallization may be beneficial for yield. The calculated atom economy of 71.56% for the reaction is satisfactory. The method of synthesis paracetamol pointed out in this report should be taken into consideration. To summarise, take into consideration all listed issues as well as adopting mentioned recommendations will significantly improve further yields.

References

Bashpa et al. (2014) ‘Polymorphism of paracetamol: A comparative study on commercial paracetamol samples.’, International Journal of Chemical Studies, 1 (No. 6), pp. [Online]. Available at: https://www.chemijournal.com/vol1Issue6/april2014/3.1.pdf (Accessed: 27.05.2021).

Srabovic et al. (January 2017) ‘Design synthesis and crystallization of acetaminophen’, Journal of Chemical, Biological and Physical Sciences, 7(1), pp. 218-230 [Online]. Available at: https://www.researchgate.net/profile/Samra-Muratovic/publication/312848234_Design_synthesis_and_crystallization_of_acetaminophen/links/588a25a3a6fdccb538f1efe5/Design-synthesis-and-crystallization-of-acetaminophen.pdf (Accessed: 27.05.2021).

(N/A) Graphic no 1 , Available at: http://www.umsl.edu/~orglab/experiments/ACETAMP.html (Accessed: 28.05.2021).