EXAM 02.05.2023

 The Polymerase chain reaction (PCR) is used to amplify and clone a specific DNA sequence (fragment)  You should be able to list all the reagents and write a brief description about their specific function  You should be able to draw up a list of criteria which need to be met whilst designing matching PCR primers  You should be able to list the pros and cons of PCR being a very sensitive method for the detection of individual DNA sequences  You should be able troubleshoot unsuccessful PCR Learning Outcomes  Temperature at which half the DNA is melted (ss) is the melting temperature or Tm  Needed to determine the annealing temperature  The Tm is dependant on the GC content of the DNA molecule Melting curve of DNA Melting Temperature (Tm ) Wallace rule: Tm = 4 * (G + C) + 2 * (A + T) Bolton and McCarthy: Tm = 81.5 + 16.6 * Log [I] + 0.41 * (%GC) – 600/L The nearest neighbor method (Santalucia et.al, 1998): Melting Temperature (Tm ) • Needed to determine the annealing temperature of a probe or PCR/sequencing primer with its complementary sequence Probe/primer Target DNA Importance of the melting temperature Theoretical calculation based on experimentation: Tm = (4 x no. GC bp) +(2 x no. AT bp) Example: 5’- TGGCAAGGCATGCACATGCAT -3’ – No of As or Ts = 10 – No. of Gs or Cs = 11 Tm = (4 x no. GC bp) +(2 x no. AT bp) Tm = (4×11) + (2×10) Tm = 640C bp = base pair Melting Temperature (Tm ) Tm = (4 x no. GC bp) + (2 x no. AT bp) Ta = Tm – 5 Annealing Temperature (Ta ) 5’- TGGCAAGGCATGCACATGCAT -3’ – No of As or Ts = 10 – No. of Gs or Cs = 11 Tm = (4 x no. GC bp) +(2 x no. AT bp) Tm = (4×11) + (2×10) Tm = 640C Ta=59°C Annealing Temperature (Ta ) Primer Pair Matching Primers work in pairs – forward primer and reverse primer. Since they are used in the same PCR reaction, it shall be ensured that the PCR condition is suitable for both of them. One critical feature is their annealing temperatures, which shall be compatible with each other. The closer their Ta are, the better. 5’ CTGATCAAGTCGATGGCTTG 3’ Fw 59 C 5’ GATGGAGAGGCTTGACTGC 3’ Rv 58 C Annealing Temperature (TA ) Principles of molecular hybridisation  G ≡ C pair = 3 H-bonds  A = T pair = 2 H-bonds  If DNA helix has a high CG content it is harder to denature – A higher temperature is needed Melting temperature (Tm ) – temperature corresponding to the mid-point in the observed transition from ds to ss DNA Primer design Primer design GCACAGGATACTCCAACCTGCCTGCCCCCATGGTCTCATCCTCCTGCTTCTGGGACCTCCTGATCCTGCCCCTGGT GCTAAGAGGCAGGTAAGGGGCTGCAGGCAGCAGGGCTCGGAGCCCATGCCCCCTCACCATGGGTCAGGCTGG ACCTCCAGGTGCCTGTTCTGGGGAGCTGGGAGGGCCGGAGGGGTGTACCCCAGGGGCTCAGCCCAGATGACA CTATGGGGGTGATGGTGTCATGGGACCTGGCCAGGAGAGGGGAGATGGGCTCCCAGAAGAGGAGTG TA Reverse complement  The specificity of the primers determines the quality of the amplification reaction  Approx. 20 nt long  Avoid repetitive sequences – primers will stick to each other and therefore not take part in the PCR reaction!  Primers could hydrogen bond (anneal) to each other  Primers could bend round and anneal to themselves  Very important: 3’ end matches well as it anneals first  5’ end can be modified for other purposes Primer design  The specificity of the primers determines the quality of the amplification reaction  Approx. 20 nt long Primer design  Too short — low specificity, resulting in non-specific amplification  Too long — decrease the template-binding efficiency at normal annealing temperature due to the higher probability of forming secondary structures such as hairpins.  Avoid repetitive sequences – primers will stick to each other and therefore not take part in the PCR reaction!  Primers could hydrogen bond (anneal) to each other  Primers could bend round and anneal to themselves Primer design Avoid complementary at 3` end of primers  Avoid repetitive sequences – primers will stick to each other and therefore not take part in the PCR reaction!  Primers could hydrogen bond (anneal) to each other  Primers could bend round and anneal to themselves Primer design Current Oligo, 20-mer [68]: Current+ Oligo: the most stable 3′-dimer: 2 bp, -1.9 kcal/mol 5′ CCAGTCGTTACAAACTGAC A 3′ 3′ ACAG T CAAACATTGCTGACC 5′ :::: | | Current- Oligo: no 3′-terminal dimer formation Current+ Oligo: the most stable dimer overall: 4 bp, -4.8 kcal/mol 5′ CC A G T CGTTACAAACTGACA 3′ 3′ ACAG T C A AACATTGCTGACC 5′ | | | | :::: :::::::: Hairpin: ²G = -0.7 kcal/mol, Loop = 8 nt, Tm = 41° 5′ CC A G T CGTT A 3′ ACAG T C A AACA | | | |  Very important: 3’ end matches well as it anneals first  5’ end can be modified for other purposes Primer design 5’ GTGGATGTGGTGTCGATGGC 3’ It’s critical that the stability at 3’ end be high 5’ 5’ 3’ 3’  Primer sequences are complementary to each DNA template strand  The primers define the sequence to be amplified/cloned Priming the reaction New nucleotides add to the 3’ end of the growing strand. (DNA (Taq) polymerase) works in the 5’-3’ direction dNTPs The first cycle of PCR dNTPs The third cycle of PCR This is good:  Forensic testing  Genetic diagnosis  Pre-natal diagnosis Sensitivity of PCR Can amplify DNA from a single cell But be careful:  Contamination  Apparatus  Operator  Environment And do not forget….. Some Practical Considerations  The reaction might be unsuccessful  No product (amplicon), weak product, nonspecific product  Primer design  Template DNA (or original sample) quality (e.g. ethanol inhibits PCR) and quantity (too much or too little)  Optimisation  Inhibitors (particularly stool samples) Primer design GCACAGGATACTCCAACCTGCCTGCCCCCATGGTCTCATCCTCCTGCTTCTGGGACCTCCTGATCCTGCCCCTGGT GCTAAGAGGCAGGTAAGGGGCTGCAGGCAGCAGGGCTCGGAGCCCATGCCCCCTCACCATGGGTCAGGCTGG ACCTCCAGGTGCCTGTTCTGGGGAGCTGGGAGGGCCGGAGGGGTGTACCCCAGGGGCTCAGCCCAGATGACA CTATGGGGGTGATGGTGTCATGGGACCTGGCCAGGAGAGGGGAGATGGGCTCCCAGAAGAGGAGTG TA Primer sequence Type of primer bp n GC n AT Primer °C Ta °C Template bp 5’ TCTGGGACCTCCTGATCCTG 3’ Forward 20 12 G/C 8 A/T Tm= 64 Ta=59 238 bp 5’ 3’ Reverse 20  Avoid repetitive sequences – primers will stick to each other and therefore not take part in the PCR reaction!  Primers could hydrogen bond (anneal) to each other  Primers could bend round and anneal to themselves Primer design Primer dimers? 1 2 3 Primer design After preparing a PCR mix using MyTaq™ Red Mix, you have run a PCR using a Ta of 65 °C for 30 cycles. The gel electrophoresis results show that the expected size fragment is present in your samples but the bands intensity is very low. Increase DNA concentration in reaction Increase cycle number to 35 Optimize annealing temperature Your results expected results How can you improve the intensity of your band? 1 2 3 Monogenic disorders: Autosomal Dominant Inheritance (AD) Dr Eva Masiero (A = dominant allele; a = recessive allele/ mutated allele) AD – Genotype & Phenotype • Homozygous (recessive)= Unaffected person – asymptomatic without mutation • Heterozygous= affected person – symptomatic with heterozygotic mutation • Homozygous (dominant)= affected person – symptomatic with homozygotic mutation – RARE!!!!!! Exercise: Predict the possible genotype and phenotype of the offspring of the following couple: Mother: symptomatic with a heterozygotic mutation Father: asymptomatic without mutation A Punnett square can be used to predict genotype and phenotypes of offspring from a genetic crosses AD – Punnett Square Vertical pedigree AD – Family tree/ Pedigree Penetrance refers to a probability that a person carrying a specific mutation (genotype) will present clinical manifestations (phenotype) AD – Penetrance Complete penetrance: people with the same mutation manifest the same clinical features Incomplete penetrance: people with the same mutation don’t manifest the same clinical features AD – Disease Disease Gene/Defect Clinical Features Hypercholesterole mia LDL receptor Impaired uptake of LDL, elevated levels of LDL cholesterol, cardiovascular disease and stroke. Huntington Disease Huntingtin (HD) – CAG repeat expansion within exon 1 Disorder is characterized by progressive motor, cognitive and psychiatric abnormalities. Marfan Syndrome Fibrillin-1 gene (FBN1) encodes a microfibril-forming connective tissue protein Abnormalities of the skeleton (disproportionate tall stature, scoliosis), heart (mitral valve prolapse, aortic dilatation, dissection of the ascending aorta), pulmonary system, skin (excessive elasticity), and joints (hypermobility). Myotonic Dystrophy Myotonic Dystrophy Muscle weakness, cardiac arrhythmias, cataracts and testicular atrophy in males Neurofibromatosi s I Microdeletion at 17q11.2 involving the NF1 gene The disorder is characterized by numerous benign tumors (neurofibromas) of the peripheral nervous system Polycystic Kidney Disease Mutations in either polycystin-1 (PKD1) or polycystin-2 (PKD2) gene Multiple renal cysts, blood in urine, end-stage renal disease and kidney failure BreastandBRCA1andBRCA2 • Average onset 30-50 years • Affects 1:20 000 people of European ancestry • Affected people are normally Heterozygous (Aa) • Median survival of 24 years from diagnosis . AD – Huntington’s disease (HD) • The part of the brain most affected by HD is a at the base of the brain called basal ganglia . The major components of the basal ganglia is the striatum Part of the brain that is involved in controlling movement HD – Pathophysiology HD – Symptoms • Alterations of the CNS are the most prominent clinical features of HD Patients also suffer from: • Metabolic and immune disturbances • Skeletal-muscle wasting • Weight loss • Cardiac failure • Osteoporosis • HTT gene codes for a protein called huntingtin • Cytogenetic Location: 4p16.3 • HTT gene contains 67 exons • Huntingtin molecular mass: 348 kD • the exact function of huntingtin is unknown Huntingtin is required for early embryonic development and in neurogenesis HD – Genetic cause Huntingtin functions https://www.cell.com/neuron/pdf/S0896-6273 (16)00096-9.pdf Huntingtin regulates: • Cell Division – spindle poles during mitosis • Endocytosis, Vesicle Recycling, and Endosomal Trafficking • Transcription – regulation of Brainderived neurotrophic factor (BDNF) Neuronal survival and growth neurotransmitt er modulator neuronal plasticity, which is essential for learning and memory //ghr.nlm.nih.gov/condition/huntington-disease#genes CAG repeat expansion Huntington gene (HTT) expanded polyglutamine tract confers toxic properties in huntingtin Neural cell death HD – Genetic cause Huntington disease is a progressive brain disorder that causes uncontrolled movements, emotional problems, and loss of thinking ability (cognition). Adult-onset Huntington disease, the most common form of this disorder, usually appears in a person’s thirties or forties. Early signs and symptoms can include irritability, depression, small involuntary movements, poor coordination, and trouble learning new information or making decisions. Many people with Huntington disease develop involuntary jerking or twitching movements known as chorea. As the disease progresses, these movements become more pronounced. Affected individuals may have trouble walking, speaking, and swallowing. People with this disorder also experience changes in personality and a decline in thinking and reasoning abilities. Individuals with the adult-onset form of Huntington disease usually live about 15 to 20 years after signs and symptoms begin. A less common form of Huntington disease known as the juvenile form begins in childhood or adolescence. It also involves movement problems and mental and emotional changes. Additional signs of the juvenile form include slow movements, clumsiness, frequent falling, rigidity, slurred speech, and drooling. School performance declines as thinking and reasoning abilities become impaired. Seizures occur in 30 percent to 50 percent of children with this condition. Juvenile Huntington disease tends to progress more quickly than the adult-onset form; affected individuals usually live 10 to 15 years after signs and symptoms appear. Mutations in the HTT gene cause Huntington disease. The HTT gene provides instructions for making a protein called huntingtin. Although the function of this protein is unclear, it appears to play an important role in nerve cells (neurons) in the brain. The HTT mutation that causes Huntington disease involves a DNA segment known as a CAG trinucleotide repeat. This segment is made up of a series of three DNA building blocks (cytosine, adenine, and guanine) that appear multiple times in a row. Normally, the CAG segment is repeated 10 to 35 times within the gene. In people with Huntington disease, the CAG segment is repeated 36 to more than 120 times. People with 36 to 39 CAG repeats may or may not develop the signs and symptoms of Huntington disease, while people with 40 or more repeats almost always develop the disorder. An increase in the size of the CAG segment leads to the production of an abnormally long version of the huntingtin protein. The elongated protein is cut into smaller, toxic fragments that bind together and accumulate in neurons, disrupting the normal functions of these cells. The dysfunction and eventual death of neurons in certain areas of the brain underlie the signs and symptoms of Huntington disease. This condition is inherited in an autosomal dominant pattern, which means one copy of the altered gene in each cell is sufficient to cause the disorder. An affected person usually inherits the altered gene from one affected parent. In rare cases, an individual with Huntington disease does not have a parent with the disorder. As the altered HTT gene is passed from one generation to the next, the size of the CAG trinucleotide repeat often increases in size. A larger number of repeats is usually associated with an earlier onset of signs and symptoms. This phenomenon is called anticipation. People with the adult-onset form of Huntington disease typically have 40 to 50 CAG repeats in the HTT gene, while people with the juvenile form of the disorder tend to have more than 60 CAG repeats. s://europepmc.org/article/PMC/5495055 HD – Genetic cause 1. Aggregation of htt mutated – neuro cell toxicity 2. Transcription dysregulation – impairment of BDNF activity 3. Altered protein homeostasis – proteasome and autophagy pathway dysregulation 4. Mitochondrial dysfunction – ROS formation and impairment of ATP production 5. Altered synaptic plasticity – dysregulation of vesicles trafficking The length of the CAG repeat is the most important factor that determines age of onset and prognosis of HD. HD – Penetrance nfortunately, there is currently no cure for Huntington disease current goal of treatment is to slow down the course of the disease and improve life-style patient Medications for: movement disorders: to suppress the involuntary jerking and writhing movements psychiatric disorders: Antidepressants HD – Treatments https://link.springer.com/article/10.1007/ HD – Antisense Oligonucleotide Therapy ASOs are synthetic, modified, single-stranded DNA molecules. Single-stranded DNA typically has a short half-life due to endonucleolytic degradation pathways so ASOs must be chemically modified to enhance stability in order to effectively reach their targets [12]. In most ASOs, this is accomplished by replacing the oxygen in the phosphodiester linkage with a sulfur to create a phosphorothioate (PS) linkage that is slightly more resistant to endonuclease activity [13]. Beyond stability, PS linkages enhance ASO distribution by forming disulfide bonds with albumin, the most abundant protein in blood plasma and the cerebrospinal fluid (CSF), which transports the ASO throughout the CNS [14, 15]. Aside from benefits to stability and distribution, PS linkages can cause immune activation. However, incorporating phosphodiester (PO) linkages into the sequence creating a mixed (PS/PO) backbone can minimize this response [16, 17]. Both the Roche/IONIS and Wave ASOs have (PS/PO) mixed backbones. By chemically modifying the phosphodiesterase backbone of DNA to create PS linkages, stereochemistry is introduced, as each PS linkage becomes a chiral center. Each chiral center has the potential to yield a pair of enantiomers, 3D molecules with non-superimposable mirror image configurations denoted as Rp or Sp. Therefore, using the 2n rule to evaluate the permutability of the molecule, an ASO that is 18 base pairs in length and has 17 PS linkages (n), such as the FDA-approved spinal muscular atrophy (SMA) ASO, nusinersen, has 131,072 stereoisomeric forms that are given to patients as a racemic mixture [18]. PS/PO mixed backbones have fewer chiral centers and stereoisomers because PO linkages are achiral. Tominersen, the Roche/IONIS mixed backbone HD ASO, has 19 linkages, but since six linkages are achiral, there are only 8192 possible forms. Theoretically, each of the 8192 resulting molecules could have different pharmacologic properties. For instance, in ASOs, comparatively speaking, the Rp stereoisomer is expected to be favored by RNase H for cleavage while the Sp configuration offers increased stability [19,20,21,22]. Together the Rp and Sp linkages seem to create a functionally balanced molecule. Tominersen is stereorandom—a mixture of both Rp and Sp linkages. Historically, the safety and potency of stereorandom drugs has been called into question. Although some stereoisomers may perform similarly therapeutic functions, there are others that are less than complementary, ranging from biologically inactive to highly toxic molecules [23, 24]. ASOs yield potentially hundreds of thousands of different stereoisomers making it technically prohibitive to use separation techniques to isolate one pure ASO molecule. In lieu of stereoisomer separation, Wave Life Sciences has developed stereocontrolled oligonucleotide synthesis with iterative capping and sulfurization (SOSICS) [22]. SOSICS grants control over the stereochemistry of each PS linkage during molecule production, allowing Wave to synthesize a single stereopure ASO molecule [25]. While this stereopure synthesis method eliminates the risk of enantiomeric impurities, controlling chirality influences drug activity [26]. Stereopure molecules composed of only Sp linkages demonstrate improved stability [22], but are significantly less potent [20]. RNase H has been reported to favor Rp linkages [19] but molecules composed of only Rp linkages do not show a significant increase in potency [20]. Controlling stereochemistry may provide enhanced stability, RNase H activity, or tolerability but the most potent ASO molecule may not be the most stable, potentially requiring a balance to be sought. Regardless of stereochemistry, PS-modified ASOs have relatively low RNA binding affinity and are still substrates for endonucleases, limiting overall drug potency. ASO bases can be modified at the 2′ carbon of the sugar ring to enhance RNA binding affinity and improve stability [27]. Nucleosides containing these 2′ sugar modifications are not substrates for endonucleases so an ASO composed completely of 2′ modified sugars would not recruit RNase H. Therefore, ASOs that induce target degradation are designed as gapmers—chimeric oligonucleotides composed of the DNA sequence ‘gap’ that is susceptible to RNaseH-mediated degradation and the flanking chemically modified RNA wings, providing stability and affinity [28].The first 2′ sugar modification was the 2′-O-methyl (2′-O-Me), which increases the melting temperature of the molecule indicating improved stability. The Wave ASOs are 2′-O-Me gapmers, as the core sequence is flanked by 2′ sugar moieties with 2′-O-Me modifications and mixed PS/PO linkages [29]. Subsequent modifications, such as the 2′-O-methoxethyl (MOE) developed by IONIS Pharmaceuticals, have even higher RNA binding affinity and proved to be more stable than 2′-O-Me modifications [30]. The Roche/IONIS ASO is a MOE gapmer, as its core sequence is flanked by 2′ sugar moieties with MOE modifications and mixed PS/PO linkages [31]. 3 Targeting HD is an autosomal dominantly inherited disease, thus the causative mtHTT gene is the first logical therapeutic target. The HTT gene is haplosufficient, meaning that, while complete inactivation of HTT is embryonically lethal [33,34,35], the deletion of one copy of HTT does not cause an overt abnormal phenotype [36]. This suggests allele-selective lowering of mtHTT as a potential treatment for HD. This would typically be achieved by targeting the disease-causing mutation for suppression. However, the CAG tract that is expanded to cause HD is present in all HTT genes as well as many other genes throughout the genome [37]. Targeting the expanded CAG tract, therefore, has the potential for off-target hybridization—where the ASO binds to a similar sequence not within the gene of interest. In lieu of targeting the mutation selectively, a nonselective approach was adopted to partially suppress both wild-type huntingtin (wtHTT) and mtHTT. In preclinical studies, 50% suppression of mtHTT is sufficient to provide benefit [38] and total HTT can be lowered by 50% without overt phenotype, [33], suggesting that appropriately dosed nonselective ASOs could provide a potentially safe and effective therapy. Nonselective ASOs, like the Roche/IONIS ASO, target HTT, indiscriminately binding to both wtHTT and mtHTT transcripts, and degrade a portion of each . While this nonselective strategy was widely pursued, population genetics studies identified single nucleotide polymorphisms (SNPs) that are in linkage disequilibrium with the CAG expansion (HD-SNPs), providing alternate targets for allele-selective mtHTT suppression [39, 40]. Human fibroblast lines were screened and selected for heterozygosity of HD-SNPs and subsequently used to screen potential allele-selective ASOs. This led to the development of a SNP-targeted ASO that discriminated and lowered fibroblastic mtHTT mRNA by a 5-fold difference compared with the wtHTT [41]. Single base-pair mismatches alter RNase H cleavage patterns, so ASOs were chemically modified to reduce RNase H activity outside the desired cleavage site, improving single nucleotide discrimination from 5-fold to 100-fold [42]. ASO selectivity was demonstrated in vivo using humanized HD mice that are heterozygous for human mtHTT and wtHTT ld[]dhllhbfifhhldfdbhldfildh DNA mutations – causes M u t a ti o n Spontaneo us Induced Physical Mutagen Chemical MutagenBiological Mutagen DNA Replication error Point mutation Frame shift mutation Spontaneous chemical changes Deaminati on Depurinati on/ Depyrimida tion • It can be either point mutations or frameshift mutation • Point Mutations: • Incorrect base pairs due to spontaneous mutation in the cell • G base pair with T and a C base pair with A • Only mismatches uncorrected before the next replication will lead to mutations Spontaneous mutation -Mistakes durinreplication • Frame Shift: • Insertions and deletions can occur spontaneously • Deletion: • DNA loops out from the template strand • DNA polymerase skips the loop-out base • Insertion: • DNA loops out from the new template strand • DNA polymerase adds a new bSpontaneous mutation -Mistakes durinreplication Replication slippage Cleavage of the bond between purine base and the deoxyribose sugar Alteration of DNA Spontaneous chemical mutation – Depurination Spontaneous chemical mutation – Deamination Removal of an amino group (NH2 ) from a base: • Deamination of C → U: Unpaired: A will be incorporated into the new DNA strand resulting in the conversion of GC pair to TA • Deamination of 5-meC → T: No repair mechanism: conversation of CG to TA DNA mutations – causes M u t a ti o n Spontaneo us Induced Due to replication error Point mutation Frame shift mutation Spontaneous lesion Deamina tion Depurinati on/ Depyrimida tion Physical Mutagen – Radiation Chemical Mutagen Biological Mutagen Induced mutations are alterations of DNA sequence after the exposure with physical and chemical agent MUTAGEN Xrays DNA mutation – Induced mutation Induced mutation – Biological agents 1. Virus– Virus DNA may be inserted into the genome which disrupts genetic function. E.g. Rous sarcoma virus, Human immunodeficiency virus 2. Bacteria– some bacteria cause inflammation – increase ROS production that can provoke DNA damage and DNA breakage. E.g: Helicobacter pylori • Ionizing (e.g. X – rays): • X rays form ions that can break covalent bonds – sugar-phosphate backbone DNA • It causes chromosomal abnormalities. Induced mutation – Physical mutagensRadiation • Ultraviolet (UV) causes photochemical changes in the DNA • Formation of dimers between adjacent pyrimidines, commonly thymine • Unpair: unusual pairing produces a bulge in the DNA strand – inhibition of replication Induced mutation – Physical mutagensRadiation Molecule of the Month: Thymine Dimers Ultraviolet light damages our DNA, but our cells have ways to correct the damage A small piece of DNA with a thymine dimer (magenta). A small piece of DNA with a thymine dimer (magenta). Download high quality TIFF image Summer is here, and we’re all heading outdoors to enjoy the sun. But remember to take your sunscreen, since too much sunlight can damage your cells. Small doses of sunlight are needed to create vitamin D, but larger doses attack your DNA. Ultraviolet light is the major culprit. The most energetic and dangerous wavelengths of UV light, termed UVC, are screened out (at least for now) by the ozone in the upper atmosphere. However, the weaker UV light, termed UVA and UVB, passes through the atmosphere and is powerful enough to cause chemical changes in the DNA. Dangerous Dimers Ultraviolet light is absorbed by a double bond in thymine and cytosine bases in DNA. This added energy opens up the bond and allows it to react with a neighboring base. If the neighbor is another thymine or cytosine base, it can form a covalent bond between the two bases. The most common reaction is shown here: two thymine bases have formed a tight thymine dimer, with two bonds gluing the bases together. The upper image is from PDB entry 1n4e and the close-up picture at the bottom is from PDB entry 1ttd . This is not a rare event: every second you are in the sun, 50 to 100 of these dimers are formed in each skin cell! Problems with Polymerases These dimers are awkward and form a stiff kink in the DNA. This causes problems when the cell needs to replicate its DNA. DNA polymerase has trouble reading the dimer, since it doesn’t fit smoothly in the active site. TT dimers like the ones shown here are not the major problem, since they are usually paired correctly with adenine when the DNA is replicated. But CC dimers do not fare as well. DNA polymerase often incorrectly pairs adenine with them instead of guanine, causing a mutation. If this happens to be in an important gene that controls the growth of cells, such as the genes for Src tyrosine kinase or p53 tumor suppressor, the mutation can lead to cancer. Error Control We spend a lot of time in the sun, so it will come as no surprise that we have a powerful mechanism for correcting these problems. Our cells use a process called nucleotide excision repair, which requires the concerted effort of a large collection of proteins that recognize the corrupted bases, clip out the section of DNA with the error, and then build a new copy of the damaged area. Other organisms have additional correction mechanisms. For instance, the enzyme on the left (PDB entry 1vas ) is an endonuclease that clips out the damaged bases, making the site available for repair. Surprisingly, this endonuclease doesn’t recognize the thymine dimer directly. You can see in this picture that the thymine dimer (colored magenta) doesn’t touch the enzyme at all. Instead, the enzyme recognizes one of the adenines that is paired with the dimer. Since the base pair is weakened by the contorted shape of the dimer, the adenine is easily flipped out and bound to a pocket in the enzyme. The enzyme on the right (PDB entry 1tez ) is a photolyase that directly breaks the bonds connecting the dimer, correcting the error in place. Ironically, photolyases use visible light to power this process. This structure captures the DNA after the thymine dimer has been fixed. Notice that the two thymine bases (colored magenta) are flipped out of the normal DNA helix and are bound in a pocket on the enzyme surface. Most DNA polymerases have a hard time replicating DNA with pyrimidine dimers. The enzyme on the left, from PDB entry 1rys , is an exception: it is designed to read through damaged DNA. It has a loose active site, so it can easily accommodate the stiff thyminedimerHoweverthisopenactivesitemakestheenzymeratherpronetoerrorsAmoretypicalDNApolymeraseisshownontherightfromPDBPhysical mutagens: thymine dimers formation Chemical mutagens alter the pairing properties and structure of DNA They can be natural and synthetic substance 1. Base analogues: any chemical that has a similar structure (i.e. is analogous) to one of the purine or pyrimidine bases in DNA or RNA. 2. Alkylating agents: modify the normal base by adding alkyl group Induced mutation – Chemical agent //biotechkhan.wordpress.com/tag/base-analogue/ Base analogs • The base analogs are similar to the base normally found in DNA • Substitution of a base analogue will result in altered base pairings Induced mutation – Chemical agent Alkylating agents • Alkylating agents are compounds adding an alkyl group to the guanine base of the DNA molecule, preventing the strands of the double helix from linking Instability of double helix stop replication (the cells can no longer divide) • Alkylating agents are used to treat several cancers Induced mutation – Chemical agent https://blog.crownbio.com/dna-damage-response DNA repair mechanisms DNA repair mechanisms – DNA proofreadin• DNA polymerase proofreading corrects most of the mismatched base pairs • 3’ to 5’ Exonuclease activity of DNA polymerase removes the wrong nucleotide and the replication can move forward Backup system for repairing errors escape from proofreading ability of DNA polymerase New DNA strand presents a mismatch base pairs Nicks directs mismatch proofreading systems to the appropriate strand A few base pairs are removed DNA polymerase fills the gap with the correct nucleotide DNA ligase seals the gap DNA repair mechanisms – DNA mismatch repair system Glycosylases enzymes detect and remove a specific kind of damaged base AP site Formation of AP sites (apurinic/apyrimidinic site) DNA polymerase fills the gap with the correct nucleotide DNA ligase seals the gap Example of spontaneous mutation repair byBERSpontaneous mutation DNA repair mechanisms – Base Excision Repair system (BER) Nucleotide excision repair recognise pyrimidine dimer or distortion in the DNA Recognition of the damage removal of a short single-stranded DNA segment that contains the lesion. DNA polymerase uses as template the undamaged single-stranded DNA to synthesize a short complementary sequence Final ligation to form a double stranded DNA is carried out by DNA ligase. Structural distortion = signal Induced mutation DNA repair mechanisms – Nucleotide Excision Repair system (NER) Disorders of the nervous system may involve the following: Vascular disorders, such as stroke, transient ischemic attack (TIA), subarachnoid hemorrhage, subdural hemorrhage and hematoma, and extradural hemorrhage Infections, such as meningitis, encephalitis, polio, and epidural abscess Structural disorders, such as brain or spinal cord injury, Bell’s palsy, cervical spondylosis, carpal tunnel syndrome, brain or spinal cord tumors, peripheral neuropathy, and Guillain-Barré syndrome Functional disorders, such as headache, epilepsy, dizziness, and neuralgia Degeneration, such as Parkinson disease, multiple sclerosis, amyotrophic lateral sclerosis (ALS), Huntington chorea, and Alzheimer disease Signs and symptoms of nervous system disorders The following are the most common general signs and symptoms of a nervous system disorder. However, each individual may experience symptoms differently. Symptoms may include: Persistent or sudden onset of a headache A headache that changes or is different, Loss of feeling or tingling, Weakness or loss of muscle strength Loss of sight or double vision, Memory loss, Impaired mental ability Lack of coordination Muscle rigidity,Tremors and seizures Back pain which radiates to the feet, toes, or other parts of the body Muscle wasting and slurred speech New language impairment (expression or comprehension) Chemic al assault Mishaps of replication fork Fracture double strand DNA Fragmentation of chromosomes Loss of genes radiation Damage of double strand DNA • Quick stick of two broken strands end together – two broken ends of the DNA are simply glued back together • Cause the lost of a few nucleotides at the cut site Figure 6.27 essential cell biology 4th Introduction of a new mutation Nonhomologous end joining system Homologous DNA strand is used as template to repair the two broken DNA strands NO introduction of a new mutation Homologous recombin What does DNA have to do with cancer? Cancer occurs when cells divide in an uncontrolled way, ignoring normal “stop” signals and producing a tumor. This bad behavior is caused by accumulated mutations, or permanent sequence changes in the cells’ DNA. Replication errors and DNA damage are actually happening in the cells of our bodies all the time. In most cases, however, they don’t cause cancer, or even mutations. That’s because they are usually detected and fixed by DNA proofreading and repair mechanisms. Or, if the damage cannot be fixed, the cell will undergo programmed cell death (apoptosis) to avoid passing on the faulty DNA. Mutations happen, and get passed on to daughter cells, only when these mechanisms fail. Cancer, in turn, develops only when multiple mutations in division-related genes accumulate in the same cell. In this article, we’ll take a closer look at the mechanisms used by cells to correct replication errors and fix DNA damage, including: Proofreading, which corrects errors during DNA replication Mismatch repair, which fixes mispaired bases right after DNA replication DNA damage repair pathways, which detect and correct damage throughout the cell cycle Proofreading DNA polymerases are the enzymes that build DNA in cells. During DNA replication (copying), most DNA polymerases can “check their work” with each base that they add. This process is called proofreading. If the polymerase detects that a wrong (incorrectly paired) nucleotide has been added, it will remove and replace the nucleotide right away, before continuing with DNA synthesis 1 1 start superscript, 1, end superscript. Proofreading: 1. DNA polymerase adds a new base to the 3′ end of the growing, new strand. (The template has a G, and the polymerase incorrectly adds a T rather than a C to the new strand.) 2. Polymerase detects that the bases are mispaired. 3. Polymerase uses 3′ to 5′ exonuclease activity to remove the incorrect T from the 3′ end of the new strand. Proofreading: DNA polymerase adds a new base to the 3′ end of the growing, new strand. (The template has a G, and the polymerase incorrectly adds a T rather than a C to the new strand.) Polymerase detects that the bases are mispaired. Polymerase uses 3′ to 5′ exonuclease activity to remove the incorrect T from the 3′ end of the new strand. Mismatch repair Many errors are corrected by proofreading, but a few slip through. Mismatch repair happens right after new DNA has been made, and its job is to remove and replace mis-paired bases (ones that were not fixed during proofreading). Mismatch repair can also detect and correct small insertions and deletions that happen when the polymerases “slips,” losing its footing on the template 2 2 squared. How does mismatch repair work? First, a protein complex (group of proteins) recognizes and binds to the mispaired base. A second complex cuts the DNA near the mismatch, and more enzymes chop out the incorrect nucleotide and a surrounding patch of DNA. A DNA polymerase then replaces the missing section with correct nucleotides, and an enzyme called a DNA ligase seals the gap 2 2 squared. Many errors are corrected by proofreading, but a few slip through. Mismatch repair happens right after new DNA has been made, and its job is to remove and replace mis-paired bases (ones that were not fixed during proofreading). Mismatch repair can also detect and correct small insertions and deletions that happen when the polymerases “slips,” losing its footing on the template 2 2 squared. How does mismatch repair work? First, a protein complex (group of proteins) recognizes and binds to the mispaired base. A second complex cuts the DNA near the mismatch, and more Base excision repair is a mechanism used to detect and remove certain types of damaged bases. A group of enzymes called glycosylases play a key role in base excision repair. Each glycosylase detects and removes a specific kind of damaged base. For example, a chemical reaction called deamination can convert a cytosine base into uracil, a base typically found only in RNA. During DNA replication, uracil will pair with adenine rather than guanine (as it would if the base was still cytosine), so an uncorrected cytosine-to-uracil change can lead to a mutation 5 5 start superscript, 5, end superscript. To prevent such mutations, a glycosylase from the base excision repair pathway detects and removes deaminated cytosines. Once the base has been removed, the “empty” piece of DNA backbone is also removed, and the gap is filled and sealed by other enzymes 6 6 start superscript, 6, end superscript. Nucleotide excision repair is another pathway used to remove and replace damaged bases. Nucleotide excision repair detects and corrects types of damage that distort the DNA double helix. For instance, this pathway detects bases that have been modified with bulky chemical groups, like the ones that get attached to your DNA when it’s exposed to chemicals in cigarette smoke 7 7 start superscript, 7, end superscript. Nucleotide excision repair is also used to fix some types of damage caused by UV radiation, for instance, when you get a sunburn. UV radiation can make cytosine and thymine bases react with neighboring bases that are also Cs or Ts, forming bonds that distort the double helix and cause errors in DNA replication. The most common type of linkage, a thymine dimer, consists of two thymine bases that react with each other and become chemically linked 8 8 start superscript, 8, end superscript. In nucleotide excision repair, the damaged nucleotide(s) are removed along with a surrounding patch of DNA. In this process, a helicase (DNA-opening enzyme) cranks open the DNA to form a bubble, and DNA-cutting enzymes chop out the damaged part of the bubble. A DNA polymerase replaces the missing DNA, and a DNA ligase seals the gap in the backbone of the strand 9 9 start superscript, 9, end superscript. Double-stranded break repair Some types of environmental factors, such as high-energy radiation, can cause double-stranded breaks in DNA (splitting a chromosome in two). This is the kind of DNA damage linked with superhero origin stories in comic books, and with disasters like Chernobyl in real life. Double-stranded breaks are dangerous because large segments of chromosomes, and the hundreds of genes they contain, may be lost if the break is not repaired. Two pathways involved in the repair of double-stranded DNA breaks are the non-homologous end joining and homologous recombination pathways. In non-homologous end joining, the two broken ends of the chromosome are simply glued back together. This repair mechanism is “messy” and typically involves the loss, or sometimes addition, of a few nucleotides at the cut site. So, non-homologous end joining tends to produce a mutation, but this is better than the alternative (loss of an entire chromosome arm) 10 10 start superscript, 10, end superscript. In homologous recombination, information from the homologous chromosome that matches the damaged one (or from a sister chromatid, if the DNA has been copied) is used to repair the break. In this process, the two homologous chromosomes come together, and the undamaged region of the homologue or chromatid is used as a template to replace the damaged region of the broken chromosome. Homologous recombination is “cleaner” than non-homologous end joining and does not usually cause mutations 11 11 start superscript, 11, end superscript. Evidence for the importance of proofreading and repair mechanisms comes from human genetic disorders. In many cases, mutations in genes that encode proofreading and repair proteins are associated with heredity cancers (cancers that run in families). For example: Hereditary nonpolyposis colorectal cancer (also called Lynch syndrome) is caused by mutations in genes encoding certain mismatch repair proteins 12 , 13 12,13 start superscript, 12, comma, 13, end superscript. Since mismatched bases are not repaired in the cells of people with this syndrome, mutations accumulate much more rapidly than in the cells of an unaffected person. This can lead to the development of tumors in the colon. People with xeroderma pigmentosum are extremely sensitive to UV light. This condition is caused by mutations affecting the nucleotide excision repair pathway. When this pathway doesn’t work, thymine dimers and other forms of UV damage can’t be repaired. People with xeroderma pigmentosum develop severe sunburns from just a few minutes in the sun, and about half will get skin cancer by the age of 10 1010 unless they avoid the sun 14 14 start superscript, 14, end superscript. 1. Deaminatio n 2. Depurinatio n a) Removal of the amine group convert cytosine base in uracil – nucleotide pairing alteration b) Removal of the purine base leads to the formation of apurinic site in the DNA strand – DNA structure alterationMatch the correct type of spontaneous mutation with the correct definition Exercise G e n e ti c D i s e a s e Monogenic Polygenic Multifactorial https://cardiovascularultrasound.biomedcentral.com/articles/10.1186/1476-7120-6-62 https://www.genome.gov/Health/Genomics-and-Medicine/Polygenic-risk-scores Heritable hypertrophic and dilated cardiomyopathies are monogenic diseases, caused by mutations in key genes that lead to the absence or abnormality of myocardial proteins [5]. Disease-causing gene mutations have been identified in approximately two-thirds of cases of hypertrophic cardiomyopathy (HCM) and about 50% of idiopathic dilated cardiomyopathy (DCM). Various types of mutations can occur in DNA, including non-sense (stop codons), missense mutations (causing aminoacid substitution) and splice-site. Mostly, newly detected mutations for heritable cardiovascular disorders are missense. For these mutations, it is difficult to establish their pathogenicity, unless specific functional test are available. Presently, pathogenicity is presumed when the substitution affects a very conserved sequence through evolution, or it was reportedly associated to disease in independent patients. The accurate reconstruction of family history is crucial element for diagnosis of genetic cardiomyopathy [6]. The family history should encompass at least 3 generations with a careful and complete history about the family members, including demographic and medical information [7]. The family history may provide additional relevant information, such as age of onset and penetrance, and help to identify the patterns of inheritance Polygenic Traits • Polygenic trait refers to a trait that is controlled by multiple non-allelic genes • Examples of polygenic traits: height, skin color, hair color, and eye color One trait Ge ne C Ge ne A Ge ne B Polygenic diseases • Polygenic disease (or polygenic disorder) results from the effects of the combined action or interaction of multiple genes • Most polygenic diseases are determined by the interactions of several genes and environmental factors ⇨ Multifactorial disease • It does not follow a Mendelian inheritance pattern • Polygenic conditions occur more frequently than monogenic diseases. • Birth defects such as neural tube defects and cleft palate • Cancers of the breast, ovaries, bowel, prostate, and skin • High blood pressure and high cholesterol • Diabetes mellitus type 2 • Alzheimer disease • Schizophrenia • Bipolar disorder • Arthritis • Osteoporosis • Skin conditions such as psoriasis, moles, and eczema • Asthma and allergies • Multiple sclerosis and other autoimmune disorders Multifactorial Diseases – types s://www.mdpi.com/2073-4425/6/1/87 Diabetes mellitus type 2 T2DM • Diabetes refers to a group of metabolic diseases characterized by hyperglycemia resulting from defects in insulin secretion, insulin action, or both • Type 1 Diabetes Mellitus (T1DM):5– 10% of all cases of diabetes • T2D is the most common form of the disease (90–95% of all cases) • T2D is a multifactorial disease: genetic + environmental factors https://www.researchgate.net/publication/ 335684432_Understanding_glycaemic_control_and_current_approaches_for_screening_antidiabetic_natural_products_fro idbddiillT2DM Type 2 Diabetes Mellitus is a complex metabolic disorder with negative consequence on longevity and quality of life. With changing lifestyles, the prevalence of diabetes is expected to rise, and there is an increasing need for novel and alternative therapies that can help manage diabetes more efficiently, affordably, and with less side-effects. Plants have been used in traditional medicinal sys-tems for successful treatment of diabetes and have great. Page 28 of 35Lankatillake et al. Plant Methods (2019) 15:105 potential as valuable alternative antidiabetic therapies   and novel drug leads. e search for antidiabetic plants and natural products rely on testing for known antihy-perglycaemic  mechanisms of action of current medi-cations prescribed for diabetes. Several experimental models including animals, isolated tissue, immortalised cell lines, and biochemical assays are utilised for screen-ing plants for antidiabetic activity. In particular, screen-ing plant extracts for inhibition of the carbohydrases α-amylase and α-glucosidase using computer-aided molecular docking studies and biochemical assays have become popular approaches due to their amenability to highthroughput screening. Modern technologies such as HR LC–MS, MSn, and NMR offer powerful tools for the detailed analysis of plant extracts to identify novel bioac-tive molecules which can be developed into novel drugs for diabetes management. e complex, multi-organ nature of diabetes necessi-tates the use of multiple experimental models as no  single model can accurately portray all the pathological aspects of the disease. e availability of a range of experimen-tal  models makes it possible to select one that is appro-priate for the aims of a study. Although there are several avenues for exploring antidiabetic properties of plants, there is a lack of standard protocols for most of the assays which makes it difficult to compare results between stud-ies. Development of standardised testing methods for known therapeutic targets of diabetes are necessary and beneficial.Abbreviations1D NMR: one-dimensional nuclear magnetic resonance; 2D NMR: two-dimensional nuclear magnetic resonance; Akt: protein kinase B (also abbrevi-ated as PKB); ALX: alloxan; BCAA : branched-chain amino acids; cAMP: cyclic adenosine monophosphate; COSY: correlation spectroscopy; CVD: cardiovascular disease; DART™: Direct Analysis in Real Time; DIO: diet-induced obesity; DKA: diabetic ketoacidosis; DKD: diabetic kidney disease; DPP-4: dipeptidyl peptidase-4; DNP: dynamic nuclear polarisation; EI: electron ionisation; ELISA: enzymelinked immunosorbent assay; ESI: electro-spray ionisation; FT-ICR MS: Fourier transform-ion cyclotron resonance mass spectrometry; G6Pase: glucose 6-phosphatase; GC–MS: gas chromatography–mass spectrometry; GDM: gestational diabetes mellitus; GIP: glucose-dependent insulinotropic peptide; GK rat: Goto-Kakizaki rat; GLP-1: glucagon-like peptide 1; GLUT4: glucose transporter type 4; GPR119: G protein-coupled receptor 119; GTP: guanosine triphosphate; GSH: glutathione; GSV: GLUT4 storage vesicle; HbA1c: glycosylated haemoglobin; HPLC: high performance liquid chromatography; HR LC–MS: high resolution liquid chromatography–mass spectrometry; HSD: high sugar diet; HSQC: heteronuclear single-quantum correlation; INS-R: insulin receptor; IR: insulin resistance; IRS-1: insulin receptor substrate 1; JCR/LA-cp rat: James C Russell/LA corpulent rat; Ki: theoretical inhibition constant; KK AY mouse: KK yellow obese mouse; KKmouse:KuoKundomouse;LC–MS:liquidchromatography–massspectrometry;LLC:liquid–liquidextraction;MS:mass https://www.mdpi.com/2073-4425/6/1/87 Genome-wide association studies (GWAS) have shown more than 100 genes susceptible to DM2 most related to: • action of insulin • insulin secretion T2DM – Genetic marks https://www.researchgate.net/publication/328344689_Polymorphisms Genome-wide association studies (GWAS) • A genome-wide association study is a research approach that aims to identify associations of genotypes with phenotypes in a particular disease • It is based on wholegenome microarrays and NGS-based wholegenome sequencing methods https://www.mdpi.com/1422- 0067/22/21/11652T2DM – Epigenetic marks • changes in DNA methylation profiles contribute to T2D onset and evolution • changes in DNA methylation occur in: • Pancreatic islets: • Altered insulin secretion • Altered β cell survival • Skeletal muscle (SK): • Altered mass and regeneration • Altered metabolism and insulin sensitivity • Adipose tissue (AT): • Impact on lipogenesis and adipokine secretion • Altered metabolism and insulin sensitivity • Liver • CAMK1D is a member of the Ca2+/calmodulin-dependent protein kinase family ⇨ activates CREBdependent gene transcription • CAMK1D may have a role in beta cell insulin secretion and survival rate ⇧ CREB-dependent gene transcription ⇧ insulin ⇩ apoptosis β cells T2DM – Epigenetic marks https://www.nature.com/articles/s41467-018- early-life exposure to various adverse environmental factors may result in an increased risk of developing T2D in adult life 50% dietary restriction (DR) throughout gestation ⇨ ⇨ reduced beta-cell mass epigenetics impairment of key genes involved in β-cell development. T2DM – Prenatal factors & Epigenetics DNA mutations – definition Permanent changes in the DNA sequence that affect genetic information Mutations may or may not affect the phenotype Normal Gene sequence Mutated RNA seq mutation mutation Faulty protein DNA mutations Mutated Gene sequence mutation Mutated amino acid sequence How common are the mutations? • Mutation occurs at a frequency of about 1 in every 1 billion base pairs • Everybody has about 6 mutations in each cell in their body If we have so many mutations why don’t we look weird????? Because most are harmless  No effect mutations: cells have very sophisticated machinery for repairing mutations very quickly Beneficial mutation: Some mutations may cause a beneficial trait  Main sources of genetic variants in population  Harmful mutations: lead to genetic disorder (down syndrome; Sickle cell anaemia; cystic fibrosis; cancer) DNA mutations – good or bad? DNA mutations – Acquired vs Inherited Acquired (somatic mutation): – Affect somatic cells – Occurs at some time during person’s life – It cannot be passed from generation to generation – Examples: cancer Inherited: – Affects germ cell line (eggs or sperm) – Occurs during the reproductions – Presents throughout person’s life in every cells in the body – it can be passed from generation to generation – Examples: cystic fibrosis, Phenylketonuria, Gaucher disease Mutation Small-scale mutation – Gene Mutation (microalteration) Large-scale mutationChromosome abnormalities (macroalteration) Chromosome abnormalities (Changing the number) Chromosome abnormalities (Changing the structure) Deletion Inversion Translocation Duplication DNA mutations – types Point Mutation Silent mutation Nonsense mutation Missense mutation Deletion Insertion Mutation Small-scale mutation – Gene Mutation (microalteration) DNA mutations – types Point Mutation Silent mutation Nonsense mutation Missense mutation Deletion Insertion Frameshift mutation Single nucleotide polymorphisms (SNPs) • SNPs are single-nucleotide substitutions of ONE base for another. • SNPs do not always affect a protein functions. • SNPs are divided in 2 groups: 1. Linked SNPs 2. Causative SNPs Point mutation – SNPs Point mutation – SNPs Substitution Normal gene sequence Nucleotide substitution could be: Transition: substitution of: • purines ↔ purines (A ↔ G) • pyrimidines ↔ pyrimidines (C ↔ T) Transversion: substitution of: • purines ↔ pyrimidines • pyrimidines ↔ purines Normal gene sequence Codon substitution could be: Synonymous substitution: the mutated codon translate for the same amino acid as the original codon Nonsynonymous substitution: the mutated codon does not translate (encode) for the same amino acid. Point mutation – SNPs Substitution Genetic code degeneracy TGC ACA CTT TGC ACG CTT ACG UGU GAA ACG UGC GAA Thr –Cys – Glu Thr – Cys – Glu DNA mRNA protein Normal Mutant The base substitution results in a change of the codon that translates for the SAME amino acid as the original codon DNA mutations – Silent mutation TGC ACA CTT TGC ACC CTT ACG UGU GAA ACG UGG GAA Thr –Cys – Glu Thr – Trp – Glu DNA mRNA protein Normal Mutant The base substitution results in a change of the codon that translates for a DIFFERENT amino acid. DNA mutations – Missense mutation DNA mutations – Missense mutation What is the effect of the mutation on the haemoglobin protein function? TGC ACA CTT TGC ACT CTT ACG UGU GAA ACG UGA GAA Thr –Cys – Glu Thr – STOP DNA mRNA protein Normal Mutant The base substitution results in a change of the codon that translates for a DIFFERENT amino acid – STOP CODON amino acid. DNA point mutations – Nonsense mutation DNA point mutations – Nonsense mutation Identified a genetic disorder associated with a non-sense mutation: Duchenne muscular Dystrophy, cystic fibrosis, spinal muscular atrophy, neurologic disorders. • Silent mutation: no effect on protein function • Missense mutation: may or may not have an effect on the protein function • Nonsense mutation: results in absence or truncated protein Often lethal at the embryonic stage Substitution mutations – effect on the proteins function • Changes the “reading frame” of a nucleotide sequence • Two types: •Insertion •Deletion • Proteins are built incorrectly Point mutation – Frameshift mutation AGC CGA TCC UCG GCU AGG Ser Ala Arg 1. Normal AGC CCG ATC C UCG GGC UAG G Ser Gly Stop 2. Insertion Insertion mutation is the addition of one or more nucleotides in a DNA sequence. Frameshift mutation – Insertion AGC CGA TCC UCG GCU AGG Ser Ala Arg 1. Normal AGC GAT CC UCG CUA GG Ser Leu 3. Deletion Deletion mutation is the loss of one or more nucleotides in a DNA sequence. Frameshift mutation – Deletion no function protein Deletion Insertion Frameshift mutation: effects on the protein function Identified a genetic disorder associated to the following DNA frameshift mutation Frameshift Mutation Genetic disease Mutation Insertion Myotonic dystrophy Fragile x syndrome Deletion Cat cry syndrome Cystic fibrosis Point mutation – Frameshift mutation https://www.researchgate.net/publication/311338547_Epigenetics_from_the_past_to_the_present pigenetics Definitions • Epi is the Greek prefix meaning “on top of or in addition to genetics.” • Chemical modification of DNA structure that changes the pattern of gene expression WITHOUT alternating DNA sequence Gene Environm ent Gene expressio n M e dicin e genetics – chromatin role – RECAP • DNA is packed into a structure called CHROMATIN • Chromatin organises gene to be accessible for transcription, replication and repair • Epigenetics change the structure of the chromatin in order to allow or not gene expression https://www.researchgate.net/publication/263097109_Altered_Histone_Modifications_in_Glioma sgenetic – chromatin modifications pigenetic – modifications searchgate.net/publication/355549121_Epigenetic_Dysregulations_in_Merkel_Cell_Polyomavirus-Driven_Merkel_Cell_Carcinoma https://www.news-medical.net/life-sciences/What-is-DNA-Methylation.aspx https://www.nature.com/articles/npp2012112 pigenetic – DNA methylation 1. methyl group (-CH3) is added to the fifth carbon atom of a cytosine ring 2. DNA methylation predominantly occurs in CpG dinucleotides (CpG islands) 3. CpG Island is a DNA sequence (200bp) in the promoter regions with a high quantity of the nucleotides G and C next to one TF 70% to 80% of CpG island are unmethylated: activation of Gene Expression TF pigenetic – DNA methylation ? What is the name and the mechanism of action of the enzyme involved in the demethylation of DNA? genetic – DNA methylation reaction DNMT: DNA methyltransferases DNMT1: Maintenance of DNA methylation following the differentiation SAM: S-adenyl DNMT3a & DNMT3b are methionine responsible for establishing NEW DNA methylation patterns during embryogenesis and setting up genomic imprints during germ cell development DNA methylation Genom ic imprin ting gene expression regulation (prooncogene, tissue specific) Xchromoso me inactivatio n Embryoni c develop ment pigenetic – DNA methylation enetic – DNA Methylation and Developm igenetic – Histone modification • It is a reversable post-translational modification of histone proteins tails • The principal covalent modifications are:  acetylation,  methylation,  phosphorylati on,  ubiquitination,  SUMOylation https://www.researchgate.net/publication/263097109_Altered_Histone_Modifications_in_Glioma igenetic – Histone modifications http://www.crystalgenomics.com/en/clinical/anticancer.html?ckattempt=1 https://www.whatisepigenetics.com/histone-modifications/2/ genetic – Histone modifications enzymes On the other hand, arginine methylation of histones H3 and H4 promotes transcriptional activation and is mediated by a family of protein arginine methyltransferases (PRMTs). There are 9 types of PRMTs found in humans but only 7 members are reported to methylate histones. They can mediate mono or dimethylation of arginine residues. Based on the position of the methyl group addition, PRMTs can be classified into type I (CARM1, PRMT1, PRMT2, PRMT3, PRMT6, and PRMT8) and type II (PRMT5 and PRMT7). Type II PRMTs are found to be strongly implicated in diseases like cancer.1 For example, PRMT5 plays a role in the repression of certain tumor suppressor genes such as RB tumor suppressors while PRMT7 overexpression is observed in breast cancer. Detection of activity and inhibition of type II PRMTs as well as other HMTs would be important in elucidating mechanisms of epigenetic regulation of gene activation and silencing, as well as benefiting cancer diagnostics and therapeutics. Histone demethylation is the removal of methyl groups in modified histone proteins via histone demethylases. These demethylases have been found to have potential oncogenic functions and involvement in other pathological processes. The discovery of histone demethylases demonstrates that histone methylation is not a permanent modification but rather a more dynamic process. Two major families of demethylases have been discovered: Lysine specific demethylase 1 (LSD1) and Jumonji domain containing (JmjC domain) histone demethylases (JMJD2, JMJD3/UTX and JARIDs). The specific amino acid residue and degree of methylation determines the demethylation enzyme. For example, on histone H3, mono- and di-methylated lysine 4 are demethylated by LSD1 (BHC110, KDM1) and tri-methylated lysine 4 by JARID (1A-1D); di- and tri-methylated lysine 27 are demethylated by JMJD3 and UTX (KDM6A) and mono- and di-methylated lysine 9 are demethylated by JMJD1 and tri-methylated lysine 9 is demethylated by JMJD2.2 Inhibition of histone demethylases may lead to histone re-methylation at specific residues important for chromatin dynamics and gene expression. Furthermore, detection of the activity and inhibition of these enzymes would be important in elucidating mechanisms of epigenetic regulation of gene activation and silencing and may benefit cancer diagnostics and therapeutics. A non-coding RNA (ncRNA) is a functional RNA molecule that is transcribed from DNA but not translated into proteins. Epigenetic related ncRNAs include miRNA, siRNA, piRNA and lncRNA. In general, ncRNAs function to regulate gene expression at the transcriptional and post-transcriptional level. Those ncRNAs that appear to be involved in epigenetic processes can be divided into two main groups; the short ncRNAs (<30 nts) and the long ncRNAs (>200 nts). The three major classes of short non-coding RNAs are microRNAs (miRNAs), short interfering RNAs (siRNAs), and piwi-interacting RNAs (piRNAs). Both major groups are shown to play a role in heterochromatin formation, histone modification, DNA methylation targeting, and gene silencing. MicroRNAs (miRNA) generally bind to a specific target messenger RNA with a complementary sequence to induce cleavage, or degradation or block translation. This may be done in the context of a feedback mechanism that involves chromosome methylation. For example, miRNA genes mir-127 and mir136 were found to be involved in regulating the genetic imprinting of Rtl1, a key gene involved in placenta formation in mice. Methylation of a specific region in the paternal chromosome results in expression of Rtl1. If the chromosome is not methylated, as on the maternal chromosome, mir-127 and mir136 are produced and bind to the Rtl1 transcript and induce degradation. Lack of Rtl1 protein expression due to improper epigenetic modifications can result in fetal death in mice.12 Short interfering RNAs (siRNA) function in a similar way as miRNAs to mediate post-transcriptional gene silencing (PTGS) as a result of mRNA degradation. In addition to this function, siRNAs have also been shown to induce heterochromatin formation via an RNA-induced transcriptional silencing (RITS) complex which when bound to siRNA promotes H3K9 methylation and chromatin condensation.3 Piwi-interacting RNAs (piRNA) are so named due to their interaction with the piwi family of proteins. The primary function of these RNA molecules involves chromatin regulation and suppression of transposon activity in germline and somatic cells. PiRNAs that are antisense to expressed transposons target and cleave the transposon in complexes with PIWI-proteins. This cleavage generates additional piRNAs which target and cleave additional transposons. This cycle continues to produce an abundance of piRNAs and augment transposon silencing.45 Long ncRNAs MlRNAlihhtidifiidihiltitiiifiiihhbdifi https://www.researchgate.net/publication/263097109_Altered_Histone_Modifications_in_Gliomas  transcriptional activation/inactivation,  chromosome packaging,  DNA damage/repair. genetic – Histone modifications role • Non coding RNAs are regulatory sequence that do not translate for any proteins • Function: negatively regulate gene expression by base pairing with a complementary mRNA sequence. • two categories based on size: 1. short chain non-coding RNAs (siRNAs, miRNAs, and piRNAs) 2. long non-coding RNA (lncRNAs) https://www.spandidos-publications.com/10.3892/or.2016.5236#:~:text=Abstract,involve%20altering%20the%20DNA%20sequence.&text=Non%2Dcoding%20RNAs%20are hllligenetic – Non-coding RNAs https://www.spandidos-publications.com/10.3892/or.2016.5236#:~:text=Abstract,involve%20altering%20the%20DNA%20sequence.&text=Non%2Dcoding%20RNAs%20are %20a,at%20the%20post%2Dtranscriptional%20level. igenetic – Non-coding RNAs genetic – X chromosome inactivation Both X chromosomes are expressed cause an impairment of the embryo development X chromosome inactivation One of the two X chromosomes is inactivated in female mammals (dosage compensation) X X X X X X X X X X X X X X Embryogenesis random inactivation Once an X-chromosome is inactivated will remain in that status throughout the lifetime of the cell genetic – X chromosome inactivation • X-chromosome inactivation is the transcriptional silencing of one X chromosome in female mammalian • random inactivation of X chromosome is regulated by Xist and Tsix genes that encode for antisense pair of non-coding RNAs https://www.sciencedirect.com/science/article/pii/S0022202X15337064 https://jbiol.biomedcentral.com/articles/10.1186/jbiol95#:~:text=X%2Dchromosome%20inactivation %20occurs%20randomly,coat%20the%20whole%20X%20chromosome. Tortoiseshell cat genetic – X chromosome inactivation mosaicism Identify an example of disease associate with a mutation of XchromosomeinactivationColor blindness, hemophilial • Genomic imprinting: when one copy of a gene is silenced due to its parental origin • The genes that undergo genomic imprinting is often marked or “stamped,” on the gene during the formation of egg and sperm cells. GAMETOGENESIS • Only a small percentage of all human genes undergo genomic imprinting. Play important role in the embryonic growth development igenetic – Genomic imprinting • Maternal imprinting: the allele of a particular gene inherited from the mother is transcriptionally silent and the paternallyinherited allele is active. • Paternal imprinting: the allele of a particular gene inherited from the father is transcriptionally silent and the maternallyinherited allele is active igenetic – Genomic imprinting https://www.geneimprint.com/site/genes-by-species Prader-Willi Syndrome -initial failure to thrive -distinctive facial features -developmental delay -hypogonadism Angelman Syndrome -seizures -jerky, uncoordinated movements -unprovoked smiling/laughter -lack of speech -severe developmental delay Paternal Maternal Deletions on chromosome 15 can result in PraderWilli or Angelman syndrome https://www.nature.com/scitable/topicpage/imprinting-and-genetic-disease-angelman-prader-willi-923 genetic – Genomic imprinting & disease https://www.frontiersin.org/articles/10.3389/fonc.2014.00071/full https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5075137/ https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5008069/ pigenetic – cancers Cancer epigenetics is the study of epigenetic modifications to the DNA of cancer cells that do not involve a change in the nucleotide sequence, but instead involve a change in the way the genetic code is expressed. Epigenetic mechanisms are necessary to maintain normal sequences of tissue specific gene expression and are crucial for normal development.[1] They may be just as important, if not even more important, than genetic mutations in a cell’s transformation to cancer. The disturbance of epigenetic processes in cancers, can lead to a loss of expression of genes that occurs about 10 times more frequently by transcription silencing (caused by epigenetic promoter hypermethylation of CpG islands) than by mutations. As Vogelstein et al. points out, in a colorectal cancer there are usually about 3 to 6 driver mutations and 33 to 66 hitchhiker or passenger mutations.[2] However, in colon tumors compared to adjacent normal-appearing colonic mucosa, there are about 600 to 800 heavily methylated CpG islands in the promoters of genes in the tumors while these CpG islands are not methylated in the adjacent mucosa.[3][4][5] Manipulation of epigenetic alterations holds great promise for cancer prevention, detection, and therapy.[6][7] In different types of cancer, a variety of epigenetic mechanisms can be perturbed, such as the silencing of tumor suppressor genes and activation of oncogenes by altered CpG island methylation patterns, histone modifications, and dysregulation of DNA binding proteins. There are several medications which have epigenetic impact, that are now used in a number of these diseases. In somatic cells, patterns of DNA methylation are in general transmitted to daughter cells with high fidelity.[8] Typically, this methylation only occurs at cytosines that are located 5′ to guanosine in the CpG dinucleotides of higher order eukaryotes.[9] However, epigenetic DNA methylation differs between normal cells and tumor cells in humans. The “normal” CpG methylation profile is often inverted in cells that become tumorigenic.[10] In normal cells, CpG islands preceding gene promoters are generally unmethylated, and tend to be transcriptionally active, while other individual CpG dinucleotides throughout the genome tend to be methylated. However, in cancer cells, CpG islands preceding tumor suppressor gene promoters are often hypermethylated, while CpG methylation of oncogene promoter regions and parasitic repeat sequences is often decreased.[11] Hypermethylation of tumor suppressor gene promoter regions can result in silencing of those genes. This type of epigenetic mutation allows cells to grow and reproduce uncontrollably, leading to tumorigenesis.[10] The addition of methyl groups to cytosines causes the DNA to coil tightly around the histone proteins, resulting in DNA that can not undergo transcription (transcriptionally silenced DNA). Genes commonly found to be transcriptionally silenced due to promoter hypermethylation include: Cyclindependent kinase inhibitor p16, a cell-cycle inhibitor; MGMT, a DNA repair gene; APC, a cell cycle regulator; MLH1, a DNA-repair gene; and BRCA1, another DNA-repair gene.[10][12] Indeed, cancer cells can become addicted to the transcriptional silencing, due to promoter hypermethylation, of some key tumor suppressor genes, a process known as epigenetic addiction.[13] Hypomethylation of CpG dinucleotides in other parts of the genome leads to chromosome instability due to mechanisms such as loss of imprinting and reactivation of transposable elements.[14][15][16][17] Loss of imprinting of insulin-like growth factor gene (IGF2) increases risk of colorectal cancer and is associated with BeckwithWiedemann syndrome which significantly increases the risk of cancer for newborns.[18] In healthy cells, CpG dinucleotides of lower densities are found within coding and non-coding intergenic regions. Expression of some repetitive sequences and meiotic recombination at centromeres are repressed through methylation [19] The entire genome of a cancerous cell contains significantly less methylcytosine than the genome of a healthy cell. In fact, cancer cell genomes have 20-50% less methylation at individual CpG dinucleotides across the genome.[14][15][16][17] CpG islands found in promoter regions are usually protected from DNA methylation. In cancer cells CpG islands are hypomethylated [20] The regions flanking CpG islands called CpG island shores are where most DNA methylation occurs in the CpG dinucleotide context. Cancer cells are deferentially methylated at CpG island shores. In cancer cells, hypermethylation in the CpG island shores move into CpG islands, or hypomethylation of CpG islands move into CpG island shores eliminating sharp epigenetic boundaries between these genetic elements.[21] In cancer cells “global hypomethylation” due to disruption in DNA methyltransferases (DNMTs) may promote mitotic recombination and chromosome rearrangement, ultimately resulting in aneuploidy when the chromosomes fail to separate properly during mitosis.[14][15][16][17] CpG island methylation is important in regulation of gene expression, yet cytosine methylation can lead directly to destabilizing genetic mutations and a precancerous cellular state. Methylated cytosines make hydrolysis of the amine group and spontaneous conversion to thymine more favorable. They can cause aberrant recruitment of chromatin proteins. Cytosine methylations change the amount of UV light absorption of the nucleotide base, creating pyrimidine dimers. When mutation results in loss of heterozygosity at tumor suppressor gene sites, these genes may become inactive. Single base pair mutations during replication can also have detrimental effects.[12] Histone modification Eukaryotic DNA has a complex structure. It is generally wrapped around special proteins called histones to form a structure called a nucleosome. A nucleosome consists of 2setsof4histones:H2A,H2B,H3,andH4.Additionally,histoneH1contributestoDNApackagingoutsideofthenucleosome.Certainhistonemodifyingenzymescanadd Other histone marks associated with tumorigenesis include increased deacetylation (decreased acetylation) of histones H3 and H4, decreased trimethylation of histone H3 Lysine 4 (H3K4me3), and increased monomethylation of histone H3 Lysine 9 (H3K9me) and trimethylation of histone H3 Lysine 27 (H3K27me3). These histone modifications can silence tumor suppressor genes despite the drop in methylation of the gene’s CpG island (an event that normally activates genes).[25][26] Some research has focused on blocking the action of BRD4 on acetylated histones, which has been shown to increase the expression of the Myc protein, implicated in several cancers. The development process of the drug to bind to BRD4 is noteworthy for the collaborative, open approach the team is taking. [27] The tumor suppressor gene p53 regulates DNA repair and can induce apoptosis in dysregulated cells. E Soto-Reyes and F Recillas-Targa elucidated the importance of the CTCF protein in regulating p53 expression.[28] CTCF, or CCCTC binding factor, is a zinc finger protein that insulates the p53 promoter from accumulating repressive histone marks. In certain types of cancer cells, the CTCF protein does not bind normally, and the p53 promoter accumulates repressive histone marks, causing p53 expression to decrease.[28] Mutations in the epigenetic machinery itself may occur as well, potentially responsible for the changing epigenetic profiles of cancerous cells. The histone variants of the H2A family are highly conserved in mammals, playing critical roles in regulating many nuclear processes by altering chromatin structure. One of the key H2A variants, H2A.X, marks DNA damage, facilitating the recruitment of DNA repair proteins to restore genomic integrity. Another variant, H2A.Z, plays an important role in both gene activation and repression. A high level of H2A.Z expression is detected in many cancers and is significantly associated with cellular proliferation and genomic instability.[11] Histone variant macroH2A1 is important in the pathogenesis of many types of cancers, for instance in hepatocellular carcinoma.[29] Other mechanisms include a decrease in H4K16ac may be caused by either a decrease in activity of a histone acetyltransferases (HATs) or an increase in deacetylation by SIRT1.[10] Likewise, an inactivating frameshift mutation in HDAC2, a histone deacetylase that acts on many histone-tail lysines, has been associated with cancers showing altered histone acetylation patterns.[30] These findings indicate a promising mechanism for altering epigenetic profiles through enzymatic inhibition or enhancement. A new emerging field that captures toxicological epigenetic changes as a result of the exposure to different compounds (drugs, food, and environment) is toxicoepigenetics. In this field, there is growing interest in mapping changes in histone modifications and their possible consequences.[31] DNA damage, caused by UV light, ionizing radiation, environmental toxins, and metabolic chemicals, can also lead to genomic instability and cancer. The DNA damage response to double strand DNA breaks (DSB) is mediated in part by histone modifications. At a DSB, MRE11-RAD50-NBS1 (MRN) protein complex recruits ataxia telangiectasia mutated (ATM) kinase which phosphorylates Serine 129 of Histone 2A. MDC1, mediator of DNA damage checkpoint 1, binds to the phosphopeptide, and phosphorylation of H2AX may spread by a positive feedback loop of MRN-ATM recruitment and phosphorylation. TIP60 acetylates the γH2AX, which is then polyubiquitylated. RAP80, a subunit of the DNA repair breast cancer type 1 susceptibility protein complex (BRCA1-A), binds ubiquitin attached to histones. BRCA1-A activity arrests the cell cycle at the G2/M checkpoint, allowing time for DNA repair, or apoptosis may be initiated.[32] MicroRNA gene silencing In mammals, microRNAs (miRNAs) regulate about 60% of the transcriptional activity of protein-encoding genes.[33] Some miRNAs also undergo methylationassociated silencing in cancer cells.[34][35] Let-7 and miR15/16 play important roles in down-regulating RAS and BCL2 oncogenes, and their silencing occurs in cancer cells.[18] Decreased expression of miR-125b1, a miRNA that functions as a tumor suppressor, was observed in prostate, ovarian, breast and glial cell cancers. In vitro experiments have shown that miR-125b1 targets two genes, HER2/neu and ESR1, that are linked to breast cancer. DNA methylation, specifically hypermethylation, is one of the main ways that the miR-125b1 is epigenetically silenced. In patients with breast cancer, hypermethylation of CpG islandslocatedproximaltothetranscriptionstartsitewasobservedLossofCTCFbindingandanincreaseinrepressivehistonemarksH3K9me3and Dysregulation of metabolism allows tumor cells to generate needed building blocks as well as to modulate epigenetic marks to support cancer initiation and progression. Cancer-induced metabolic changes alter the epigenetic landscape, especially modifications on histones and DNA, thereby promoting malignant transformation, adaptation to inadequate nutrition, and metastasis. In order to satisfy the biosynthetic demands of cancer cells, metabolic pathways are altered by manipulating oncogenes and tumor suppressive genes concurrently.[38] The accumulation of certain metabolites in cancer can target epigenetic enzymes to globally alter the epigenetic landscape. Cancerrelated metabolic changes lead to locus-specific recoding of epigenetic marks. Cancer epigenetics can be precisely reprogramed by cellular metabolism through 1) doseresponsive modulation of cancer epigenetics by metabolites; 2) sequence-specific recruitment of metabolic enzymes; and 3) targeting of epigenetic enzymes by nutritional signals.[38] In addition to modulating metabolic programming on a molecular level, there are microenvironmental factors that can influence and effect metabolic recoding. These influences include nutritional, inflammatory, and the immune response of malignant tissues. DNA damage appears to be the primary underlying cause of cancer.[39] [40] If DNA repair is deficient, DNA damage tends to accumulate. Such excess DNA damage can increase mutational errors during DNA replication due to error-prone translesion synthesis. Excess DNA damage can also increase epigenetic alterations due to errors during DNA repair.[41][42] Such mutations and epigenetic alterations can give rise to cancer (see malignant neoplasms). Germ line mutations in DNA repair genes cause only 2–5% of colon cancer cases.[43] However, altered expression of microRNAs, causing DNA repair deficiencies, are frequently associated with cancers and may be an important causal factor for these cancers. Over-expression of certain miRNAs may directly reduce expression of specific DNA repair proteins. Wan et al.[44] referred to 6 DNA repair genes that are directly targeted by the miRNAs indicated in parentheses: ATM (miR-421), RAD52 (miR-210, miR-373), RAD23B (miR-373), MSH2 (miR-21), BRCA1 (miR-182) and P53 (miR-504, miR-125b). More recently, Tessitore et al.[45] listed further DNA repair genes that are directly targeted by additional miRNAs, including ATM (miR-18a, miR-101), DNA-PK (miR-101), ATR (miR185), Wip1 (miR-16), MLH1, MSH2 and MSH6 (miR-155), ERCC3 and ERCC4 (miR-192) and UNG2 (mir-16, miR-34c and miR-199a). Of these miRNAs, miR-16, miR-18a, miR-21, miR-34c, miR-125b, miR-101, miR-155, miR-182, miR-185 and miR-192 are among those identified by Schnekenburger and Diederich[46] as over-expressed in colon cancer through epigenetic hypomethylation. Over expression of any one of these miRNAs can cause reduced expression of its target DNA repair gene. Up to 15% of the MLH1-deficiencies in sporadic colon cancers appeared to be due to over-expression of the microRNA miR-155, which represses MLH1 expression.[47] However, the majority of 68 sporadic colon cancers with reduced expression of the DNA mismatch repair protein MLH1 were found to be deficient due to epigenetic methylation of the CpG island of the MLH1 gene.[48] In 28% of glioblastomas, the MGMT DNA repair protein is deficient but the MGMT promoter is not methylated.[49] In the glioblastomas without methylated MGMT promoters, the level of microRNA miR-181d is inversely correlated with protein expression of MGMT and the direct target of miR-181d is the MGMT mRNA 3’UTR (the three prime untranslated region of MGMT mRNA).[49] Thus, in 28% of glioblastomas, increased expression of miR-181d and reduced expression of DNA repair enzyme MGMT may be a causal factor. In 29–66%[49][50] of glioblastomas, DNA repair is deficient due to epigenetic methylation of the MGMT gene, which reduces protein expression of MGMT. High mobility group A (HMGA) proteins, characterized by an AT-hook, are small, nonhistone, chromatin-associated proteins that can modulate transcription. MicroRNAs control the expression of HMGA proteins, and these proteins (HMGA1 and HMGA2) are architectural chromatin transcription-controlling elements. Palmieri et al.[51] showed that, in normal tissues, HGMA1 and HMGA2 genes are targeted (and thus strongly reduced in expression) by miR-15, miR-16, miR-26a, miR-196a2 and Let-7a. HMGA expression is almost undetectable in differentiated adult tissues but is elevated in many cancers. HGMA proteins are polypeptides of ~100 amino acid residues characterized by a modular sequence organization. These proteins have three highly positively charged regions, termed AT hooks, that bind the minor groove of AT-rich DNA stretches in specific regions of DNA. Human neoplasias, including thyroid, prostatic, cervical, colorectal, pancreatic and ovarian carcinoma, show a strong increase of HMGA1a and HMGA1b proteins.[52] Transgenic mice with HMGA1 targeted to lymphoid cells develop aggressive lymphoma, showing that high HMGA1 expression is not only associated with cancers, but that the HMGA1 gene can act as an oncogene to cause cancer.[53] Baldassarre et al.,[54] showed that HMGA1 protein binds to the promoter region of DNA repair gene BRCA1 and inhibits BRCA1 promoter activity. They also showed that while only 11% of breast tumors had hypermethylation of the BRCA1 gene, 82% of aggressive breast cancers have low BRCA1 protein expression, and most of these reductions were due to chromatin remodeling by high levels of HMGA1 protein. tics in Cancer. Manel Esteller. N Engl J Med 2008;358:1148-59. pigenetic – case studies https://citeseerx.ist.psu.edu/viewdoc/download?doi=10.1.1.1090.5634&rep=rep1&type=pdf https://www.frontiersin.org/articles/10.3389/fpsyt.2019.00808/full%20 https://www.sciencedirect.com/science/article/pii/B9780128053881000316 Sickle-cell anemia is one of hundreds of life-threatening disorders that are known to be caused by a change in just one of those 3 billion A’s, T’s, C’s, or G’s. Because so many diseases are associated with mutations, it is common for mutations to have a negative connotation. However, while many mutations are indeed deleterious, others are “silent”; that is, they have no discernible effect on the phenotype of an individual and remain undetected unless a molecular biologist takes a DNA sample for sequence analysis. In addition, some mutations are actually beneficial. For example, the very same mutation that causes sickle-cell anemia in affected individuals (i.e., those people who have inherited two mutant copies of the beta globin gene) can confer a survival advantage to unaffected carriers (i.e., those people who have inherited one mutant copy and one normal copy of the gene, and who generally do not show symptoms of the disease) when these people are challenged with the malaria pathogen. As a result, the sickle-cell mutation persists in populations where malaria is endemic. Beyond the individual level, perhaps the most dramatic effect of mutation relates to its role in evolution; indeed, without mutation, evolution would not be possible. This is because mutations provide the “raw material” upon which the mechanisms of natural selection can act. By way of this process, those mutations that furnish individual organisms with characteristics better adapted to changing environmental conditions are passed on to offspring at an increased rate, thereby influencing the future of the species. The Relationship Between Mutations and Polymorphisms While a mutation is defined as any alteration in the DNA sequence, biologists use the term “single nucleotide polymorphism” (SNP) to refer to a single base pair alteration that is common in the population. Specifically, a polymorphism is any genetic location at which at least two different sequences are found, with each sequence present in at least 1% of the population. Note that the term “polymorphism” is generally used to refer to a normal variation, or one that does not directly cause disease. Moreover, the cutoff of at least 1% prevalence for a variation to be classified as a polymorphism is somewhat arbitrary; if the frequency is lower than this, the allele is typically regarded as a mutation (Twyman, 2003). SNPs are important as markers, or signposts, for scientists to use when they look at populations of organisms in an attempt to find genetic changes that predispose individuals to certain traits, including disease. On average, SNPs are found every 1,000–2,000 nucleotides in the human genome, and scientists participating in the International HapMap Consortium have mapped millions of these alterations (International Human Genome Sequencing Consortium, 2001). The DNA in any cell can be altered through environmental exposure to certain chemicals, ultraviolet radiation, other genetic insults, or even errors that occur during the process of replication. If a mutation occurs in a germ-line cell (one that will give rise to gametes, i.e., egg or sperm cells), then this mutation can be passed to an organism’s offspring. This means that every cell in the developing embryo will carry the mutation. As opposed to germ-line mutations, somatic mutations occur in cells found elsewhere in an organism’s body. Such mutations are passed to daughter cells during the process of mitosis (Figure 2), but they are not passed to offspring conceived via sexual reproduction. How Mutations Occur As previously mentioned, DNA in any cell can be altered by way of a number of factors, including environmental influences, certain chemicals, spontaneous mutations, and errors that occur during the process of replication. Each of these mechanisms is discussed in greater detail in the following sections. DNA interacts with the environment, and sometimes that interaction can be detrimental to genetic information. In fact, every time you go outside, you put your DNA in danger, because ultraviolet (UV) light from the Sun can induce mutations in your skin cells. One type of UV-generated mutation involves the hydrolysis of a cytosine base to a hydrate form, causing the base to mispair with adenine during the next round of replication and ultimately be replaced by thymine. Indeed, researchers have found an extremely high rate of occurrence of this UV-induced C-to-T fingerprint-type mutation in genes associated with basal cell carcinoma, a form of skin cancer (Seidl et al., 2001). UV light can also cause covalent bonds to form between adjacent pyrimidine bases on a DNA strand, which results in the formation of pyrimidine dimers. Repair machinery exists to cope with these mutations, but it is somewhat prone to error, which means that some dimers go unrepaired. Furthermore, some people have an inherited genetic disorder called xeroderma pigmentosum (XP), which involves mutations in the genes that code for the proteins involved in repairing UV-light damage. In people with XP, exposure to UV light triggers a high frequency of mutations in skin cells, which in turn results in a high occurrence of skin cancer. As a result, such individuals are unable to go outdoors during daylight hours. In addition to ultraviolet light, organisms are exposed to more energetic ionizing radiation in the form of cosmic rays, gamma rays, and X-rays. Ionizing radiation induces double-stranded breaks in DNA, and the resulting repair can likewise introduce mutations if carried out imperfectly. Unlike UV light, however, these forms of radiation penetrate tissue well, so they can cause mutations anywhere in the body. Mutations Caused by Chemicals Oxidizing agents, commonly known as free radicals, are substances that can chemically modify nucleotides in ways that alter their base-pairing capacities. For instance, dioxin intercalates between base pairs, disrupting the integrity of the DNA helix and predisposing that site to insertions or deletions. Similarly, benzo[a]pyrene, a known carcinogen and a component of cigarette smoke, has been demonstrated to induce lesions at guanine bases in the tumor suppressor gene P53 at codons 157, 248, and 273. These codons are the major mutational hot spots seen in clinical studies of human lung cancers (Denissenko et al., 1996). Mutations such as these that are fairly specific to particular mutagens are called signature mutations. A variety of chemicals beyond those mentioned here are known to induce such mutations. Spontaneous Mutations Mutations can also occur spontaneously. For instance, depurination (Figure 5), in which a purine base is lost from a nucleotide through hydrolysis even though the sugar-phosphate backbone is unaltered, can occur without an explicit insult from the environment. If uncorrected by DNA repair enzymes, depurination may result in the incorporation of an incorrect base during the next round of replication. Karyotype analysis: Introduction • Karyotyping: the process of pairing and ordering all the chromosome of an individual -> pictorial /photographic representation <- size order • Example: 46, XX; 46, XY; 104, Carp; 8, Fruit fly Tang, Q., Chen, Q., Lai, X. & Lui, S., 2013. Malignant Transformation Potentials of Human Umbilical Cord Mesenchymal Stem Cells Both Spontaneously and via 3-Methycholanthrene Induction. PLoS ONE, 8(12), p. e81844. Karyotype analysis: Procedure • Sample: general diagnosis -> peripheral blood specimens or skin biopsy cancer diagnosis -> tumour biopsy or bone marrow prenatal diagnosis -> amniotic fluid or chorionic villus 0.5 ml blood in 5 ml culture medium Add phytohaemagglutinin Culture 48-72 hours Add colcemid Add hypotonic KCL and fix in 3:1 Methanol: Acetic acid Drop on to microscope slide Digest with trypsin and stain with Giemsa Cells arrested in the metaphase Karyotype analysis: Nomenclature • Key points • p (petite) -> short arm • q (queue) -> long arm • Metacentric chromosome -> length of p = q • Submetacentric chromosome -> length of p < q • Acrocentric chromosome -> length of p << q Karyotype analysis: Nomenclature • Key points • p (petite) -> short arm • q (queue) -> long arm • Metacentric chromosome -> length of p = q • Submetacentric chromosome -> length of p < q • Acrocentric chromosome -> length of p << q • Chromosomal region decoding: 5p31.2 • 5 = • p = • 3 = • 1 = • 2 = “5p31.2 = five p three one point two” Karyotype analysis: Application • Abnormalities detection -> diagnosis confirmation • Numerical: change in number of chromosomes • Polyploidy: possession of an extra SET of chromosomes -> rare in human • Aneuploidy: absence or addition of a chromosome -> n = 45 or n = 47 example -> an extra copy of chromosome = trisomy -> missing a copy of chromosome = monosomy • Structural: change in structure of chromosomes <- loss or duplication of fragments / chromosomal arm Balanced Translocation (t) A portion of chromosome exchanges place with a portion from another chromosome Inversion (inv) A segment of chromosome breaks off, turns upside-down and reattaches itself Insertion (ins) A segment of chromosome is inserted to another chromosome Unbalanced Deletion (del) A portion of chromosome is lost Duplication (dup) A portion of chromosome is duplicated Karyotype analysis: Application • Abnormalities detection -> diagnosis confirmation • Numerical: change in number of chromosomes • Structural: change in structure of chromosomes <- loss or duplication of fragments / chromosomal arm ______________ ____________ _______________ ________________ ________________ Chromosome abnormalities – Numerical • Polyploidy: Triploidy (69, XXX or 69, XXY) • A condition with three complete sets of chromosomes in a single cell • Prevalence: 1 in 50,000 live birth infants • Nearly all triploid pregnancies are spontaneously aborted during the first trimester • Causes: 1 egg + 2 sperms, 1 egg + 1 sperm (2n), 1 egg (2n) +1 sperm, 1 fertilised egg + 1 sperm Wick, J. B., Johnson, K. J., O’Brien, J., & Wick, M. J. (2012). Second-trimester diagnosis of triploidy: a series of four cases. AJP reports, 3(1), 37-40. Chromosome abnormalities – Numerical • Polyploidy: Tetraploidy (92, XXXX or 92, XXYY) • A condition with four complete sets of chromosomes in a single cell • Prevalence: rare • Majority of tetraploid pregnancies are spontaneously aborted • Causes: chromosome duplication in a somatic cell in an early stage embryo, 2n egg + 2n sperm • Intrauterine hypotrophy • Postnatal growth retardation • High and prominent forehead • Low-set and dysplastic ears • Feet and hand abnormality • Beaked nose and micrognathia Bothur-Nowacka J, Jezela-Stanek A., Zaniuk K., Goryluk-Kozakiewicz B., KrajewskaWalasek M. and Dobrzańska A (2013), Tetraploidy in the era of molecular karyotyping – What we need to remember, Pediatria Polska 88(5), 467-471 Chromosome abnormalities – Numerical • Aneuploidy: monosomy X (45, X – Turner syndrome) • Partial or complete loss of an X chromosome in females • Prevalence: 1 in 2,500 newborn girls • Nearly all pregnancy are spontaneously aborted • Life expectancy: 30 – 40 years <- cardiac problem Chromosome abnormalities – Numerical • Aneuploidy: monosomy (45, X – Turner syndrome) • Clinical features • Sexual immaturity • Learning difficulty – normal intelligence • A short stature – under 5 feet in height • A web between the neck and shoulders • Low posterior hairline • Lymphatic abnormalities https://www.omicsonline.org/united-states/turner-syndrome-peer-reviewed-pdf-pptarticles/ Chromosome abnormalities – Numerical • Aneuploidy: trisomy (47, XXY – Klinefelter syndrome) • One Y chromosome and multiple X chromosomes • Prevalence: 1 in 500 to 1,000 newborn boys • Life expectancy: normal Chromosome abnormalities – Numerical • Aneuploidy: trisomy (47, XXY – Klinefelter syndrome) • Clinical features • A tall stature • Long limbs with large hands and feet • Have male genitalia with small testes • Infertile • Gynecomastia with slight widen hips • Learning difficulties • Curvature of spine and osteoporosis Learning objectives • At the end of the session you should be able to • Describe the karyotype and clinical features of chromosomal abnormalities • Numerical: aneuploidy – autosomal chromosome • Trisomy 13 – Patau’s syndrome • Trisomy 18 – Edwards’ syndrome • Trisomy 21 – Sporadic Down’s syndrome • Structural: • Balanced – Familial Down’s syndrome • Unbalanced – Cri-du-chat syndrome and Charcot-Marie-Tooth Type 1A syndrome Karyotype analysis: Recap • Karyotyping: the process of pairing and ordering all the chromosome of an individual -> pictorial /photographic representation <- size order • Example: 46, XX; 46, XY; 104, Carp; 8, Fruit fly Tang, Q., Chen, Q., Lai, X. & Lui, S., 2013. Malignant Transformation Potentials of Human Umbilical Cord Mesenchymal Stem Cells Both Spontaneously and via 3-Methycholanthrene Induction. PLoS ONE, 8(12), p. e81844. Karyotype analysis: Recap • Abnormalities detection -> diagnosis confirmation • Numerical: change in number of chromosomes • Polyploidy: possession of an extra SET of chromosomes -> rare in human • Aneuploidy: absence or addition of a chromosome -> n = 45 or n = 47 example -> an extra copy of chromosome = trisomy -> missing a copy of chromosome = monosomy • Structural: change in structure of chromosomes <- loss or duplication of fragments / chromosomal arm Balanced A portion of chromosome exchanges place with a portion from another chromosome A segment of chromosome breaks off, turns upside-down and reattaches itself A segment of chromosome is inserted to another chromosome Unbalanced A portion of chromosome is lost A portion of chromosome is duplicated Chromosome abnormalities – Numerical • Aneuploidy: trisomy 13 – Patau’s syndrome • Extra copy of chromosome 13 • Clinical features • Holoprosencephaly/microcephaly • Learning disabilities • Microphthalmia • Cleft lip/palate • Rocket bottom feet • Polydactyly • Renal dysplasia Chromosome abnormalities – Numerical • Aneuploidy: trisomy 18 – Edwards’ syndrome • Extra copy of chromosome 18 Chromosome abnormalities – Numerical • Aneuploidy: trisomy 18 – Edwards’ syndrome • Clinical features • Overlapping of the index finger – clenched • Prominent occiput • Severe learning difficulties • Low birth weight • Heart defect Chromosome abnormalities – Numerical • Aneuploidy: trisomy 21 – Sporadic Down’s syndrome • Extra copy of chromosome 21 Chromosome abnormalities – Numerical • Aneuploidy: trisomy 21 – Down’s syndrome • Clinical features • Flattened nose and face • A single transverse palmer crease • Open mouth with protruding tongue • Space between first and second toes • Congenital heart disease • Hypothyroidism • Learning difficulties Chromosome abnormalities – Structural • Familial Down’s syndrome • Balanced structural abnormality • Translocation of genetic material between chromosome 14 and chromosome 21 -> 3 copies of chromosome 21 • Clinical feature is the same as sporadic Chromosome abnormalities – Structural • Cri-du-chat (Cat’s cry) syndrome • Unbalanced structural abnormality • Chromosome 5p deletion – vary in size • Clinical features • High pitched cry (cat’s like) • Microcephaly • Round face • Broad nasal bridge • Low-set ears • Severe learning disabilities Chromosome abnormalities – Structural • Charcot-Marie-Tooth Type 1A syndrome • Unbalanced structural abnormality • Duplication of PMP22 gene on 17p https://www.msdmanuals.com/en-gb/home/brain,-spinal-cord,-and-nervedisorders/peripheral-nerve-and-related-disorders/charcot-marie-toothdisease Genetic inheritance: Autosomal dominant and recessive X-linked recessive Chromosome abnormalities – Structural • Charcot-Marie-Tooth Type 1A syndrome • Unbalanced structural abnormality • Duplication of PMP22 gene on 17p • Clinical features • Severe neuropathy – hands and lower legs • Progressive muscle weakness • Bilateral foot drop https://www.bbc.co.uk/news/av/uk -england-leicestershire-58501877 https://www.bbc.co.uk/news/uk-wales-63303838 Monogenetic Disorder • Monogenic disorders (monogenic traits) are caused by variations in a SINGLE gene • Often manifest during childhood and lead to morbidity and sometimes premature death • Rare diseases that affect about 6% of people • It is typically inherited in a classical Mendelian fashion • The three most common patterns of inheritance are: 1. Autosomal dominant 2. Autosomal recessive 3. X-linked recessive Term Meaning Gene A segment of DNA which specifies a functional polypeptide and it is passed from parents to offspring Allele A variant form of a particular gene Genotype The genetic makeup of an organism (AA, Aa and aa) Homozyg ous Having two identical alleles for a particular gene (AA, aa) Heterozy gous Having two different alleles for a particular gene (Aa) Phenotyp e The physical characteristics of an organism (such as: tall) Punnet Square Diagram that can be used to predict the genotype and phenotypes resulting from a genetic cross Pedigree A genetic representation of a family tree that shows the presence or absence of a phenotype within a family acrossgenerations.Terminology Allele Pedigre Punnett Square A Punnett square can be used to predict genotype and phenotypes of offspring of a single trail (allele) b b B B b Father genotype Bb b B: dominant brown eyes allele B b b b bb Mother genotype bb Punnett Square Pedigree charts – Family tree Autosomal Recessive Inheritance Mutated gene is on one of the autosomes chromosomes (1-22) TWO mutated alleles (one inherited from each parent) need to be present for the phenotype/disease Process by which genetic information is passed on from parent to child (AR)  Homozygous AA = unaffected person – asymptomatic without mutation  Homozygous aa = Affected person – symptomatic with homozygotic mutation  Heterozygous Aa = Carrier person – asymptomatic with heterozygotic mutation (A = dominant allele; a = recessive allele/ mutated allele) AR – Genotype & Phenotype calculate the probability of the possible genotype and phenotype of the offspring of the following couple: Mother: asymptomatic with a heterozygotic mutation Father: asymptomatic without mutation A a A A Father Mother A Punnett square can be used to predict genotype and phenotypes of offspring from a genetic crosses AR – Punnett Square Horizontal pedigree AR – Family tree/ Pedigree Consanguinity increases the probability to acquire a autosomal recessive conditions amongst children from parents which are related each other Increase the probability to acquire both faulty genes AR – Consanguinity AR – Disease System Disorder Metabolic Cystic Fibrosis Phenylketonuria Galactosemia Homocystinuria Lysosomal storage disease Wilson disease Hemochromatosis Glycogen storage disease Hematopoietic Sickle cell anemia Thalassemia Endocrine Congenital adrenal hyperplasia Skeletal Alkaptonuria Nervous Neurogenic muscular atrophies Friedreich ataxia Spinalmuscularatrophy • It is a life-threatening disorder that causes severe damage to lungs, digestive system and reproductive systems • 1:2500 incidence in North of Europe • 75% of people with CF are diagnosed by age 2 • Mutations in Cystic fibrosis transmembrane conductance regulator gene (CFTR) (7q31) AR – Cystic Fibrosis (CF) Lungs: Thick mucus builds up and gets stuck in the airways: – Persistent coughing – Trouble breathing – Continuous infection Digestive system: Thick mucus blocks pancreatic ducts. Digestive enzymes can’t get through to the stomach: malabsorption of nutrients – Poor growth or poor weight gain despite a good appetite https://pedsinreview.aappublications.org/content/ //Reproductive system : Men: thick mucus can block sperm release Women: thick mucus can reduce sperm from entering their reproductive system CF – Symptoms: Very salty-tasting skin Medical genetics –e-book; Lynn B. Jorde, John C. Carey, and Michael J. Bamshad Pancre as Lungs Picture from: https://www.frontiersin.org/articles/10.3389/fphar.2019.01662/fulCF – Genetic causes • CFTR gene codes for a cystic fibrosis transmembrane conductance regulator (CFTR) protein • Cytogenetic Location: 7q31.2 • CFTR protein is a member of the ATP-binding cassette (ABC) transporter superfamily. • CFTR channel is found on the surface membrane of epithelia cells Picture from: https://www.frontiersin.org/articles/10.3389/fphar.2019.01662/full CF – Genetic causes CFTR protein has 5 domains: 2x transmembrane domains (TMD1 and TMD2) 2x nucleotide-binding domains (NBD1 and NBD2) 1x Regulatory domain (RD) form the channel pore ATP binding and hydrolysis Regulate opening and closing gate helps to control the movement of water in tissues necessary to produce thin, freely flowingmucus• CFTR protein functions as a channel across the membrane of cells that produce: • CFTR regulated the transport of chloride ions (Cl− ) across epithelial cell membranes • mucus • sweat • saliva • tears • digestive enzymes CF – Genetic causes https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3372304 CF – Genetic causes • More than 2000 mutations in the CFTR gene have been identified in people with CF • CFTR mutations may impair mRNA and protein expression, function, stability or a combination of these • Mutations in the CFTR gene disrupt the flow of Cl− ions and H2O across cell membranes → accumulation of thick and sticky mucus • F508del is the most prevalent CF-causing mutationaffectingapproximately82%of Identify how many different classes of CFTR mutations there are and summarise the effect of each mutation classes on the CFTR protein function. Best practice guidelines for molecular genetic diagnosis of cystic fi brosis and CFTR-related disorders – updated European recommen dations – PMC (nih.gov) CF – extra reading CF – Diagnosis • Sweat test: it measures the amount of salt chemicals (sodium and chloride) in the sweat.(>60 mmol/L – reference value <30 mmol/L) • Newborn screening test: measurement of the level of ImmunoReactive Trypsinogen (IRT) (chemical released by the pancreas) • Carrier testing: A simple mouthwash or blood test can determine if you are a carrier of the defective gene that causes cystic fibrosis CF – Diagnosis in adults most cases of CF are now diagnosed shortly after birth but sometimes the condition may not be diagnosed until later in life → partial functionality of CFTR • Family history • sweat test • blood test, • sputum (mucus) test, • lung function test to measure breathing • X-ray, CT scan, and/or MRI – lung physiology CF – Treatments Medication Actions Antibiotics Treat and prevent lung infections Anti-inflammatory Reduce swelling in the airways in lungs Mucus-thinning drugs (hypertonic saline) cough up the mucus Inhaled medications (bronchodilators) keep airways open by relaxing the muscles around bronchial tubes Oral pancreatic enzymes help digestive tract absorb nutrients Target therapy – CFTR modulator therapies correct the malfunctioning CFTR protein – specific mutation CFTR modulator therapies • CFTR modulators are a class of drugs that act by improving: • production • intracellular processing • and/or function • CFTR modulators have been approved by the U.S. Food and Drug Administration (FDA) for people with the specific CF mutations • There are four CFTR modulators for people with certain CFTR mutations: • Kalydeco® (ivacaftor) • Orkambi® (lumacaftor/ivacaftor) • Symdeko® (tezacaftor/ivacaftor) • Trikafta® (elexacaftor/tezacaftor/ivacaftor) most used https://www.frontiersin.org/articles/10.3389/fphar.2019.01662/full defective CFTR protein  Potentiators: Therapeutic agents that improve the channel-open probability and potentiate mutated CFTR gating  Correctors: are small molecules that improve the trafficking of mutated CFTR (Class II mutations, e.g., F508del) from ER to the apical PM and increase CFTR cell surface expression.  Read-through agents: reduce the ribosomal ability to proofread and enable ribosomes to skip the stop codon, leading to the formation of functional protein.  Amplifiers: are compounds that enhance the expression of CFTR protein, with a following increase of its quantity in the ER and the PM. https://www.nhs.uk/news/genetics-and-stem-cells/gene-therapy-breakthrough-for-cystic-fibrosis/ https://www.frontiersin.org/articles/10.3389/fphar.2018.01381/full Others CFTR therapies Personalised medicine National Heart, Lung, and Blood Institute (USA): “Personalised medicine is the use of diagnostic and screening methods to better manage the individual patient’s disease or predisposition toward a disease…” Personalised medicine • Traditional medicine: ‘One size fits’ all approach • Personalised medicine: Customised treatment for individual patients • Personalised medicine uses patient genotype and phenotype to tailor treatment strategy to the patient Technology • Personalised medicine has been made possible by: • Increasing technology • Decreasing sequencing costs The Human Genome Project and personalised medicine The Human Genome Project and subsequent projects (eg 100 000 Genomes, the new GenOMICC COVID-19 Study) are enabling information from our genome to be used in medicine https://www.nature.com/news/personalized-medicine-time-for-one-person-trials-1.17411 Illustration by Greg Clarke https://covid.genomicc.org/ Four ‘P’s of Personalised Medicine (NHS England) • Prevention and prediction: Identifying genetic disease and those at increased risk • Precise diagnosis: Symptom based diagnosis is less accurate than genetics • Personalised targeted interventions: Move away from trial and error prescribing where drugs are currently effective in only 30-60% of patients due to differing individual responses to drugs • Participation of patients: Increase in data allows personalised consultations and lifestyle changes https://pixabay.com/ Personalised medicine will provide opportunities to improve how we treat disease (NHS England) All patients with the same condition are given the same treatment. Assumes all patients respond to a drug in the same way https://www.england.nhs.uk/wpcontent/uploads/2016/09/improvingoutcomes-personalised-medicine.pdf Traditionally: https://www.england.nhs.uk/wpcontent/uploads/2016/09/improvingoutcomes-personalised-medicine.pdf Lung cancer – NHS molecular diagnosis and treatment stratification 3 Treatment stratified (divided into different groups) 1 Patients diagnosed with lung cancer 2 Mutation analysis 1 2 2 2 2 3 3 3 3 Personalising lung cancer treatment • Tailoring treatment to the underlying cause of the cancer • NHS testing for: – Epidermal growth factor receptor tyrosine kinase (EGFR-TK) mutation – Anaplastic lymphoma kinase (ALK) mutation • One of the most common and most serious types of cancer • Early diagnosis can make a big difference but lung cancer does not usually cause noticeable symptoms until it has spread through the lungs or into other parts of the body • Approximately 1 in 3 people live for at least a year after diagnosis • 85% of cases caused by smoking Lung cancer https://www.nhs.uk/conditions/lung-cancer/ https://www.theverge.com/ 2016/4/4/11345936/france-plain-cigarettepack-law https://www.nhs.uk/better-health/quit-smokin g/?WT.mc_ID=JanQuitSmokingPPC& Lung cancer • Traditional medicine: ‘One size fits’ all approach • Patient diagnosed with lung cancer receives traditional treatment Surgery removes cancer cells Chemotherapy drugs kill cancer cells Radiotherapy: targeted radiation kills cancer cells Lung cancer https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4367711/ Histology Histology Sequencing IHC/FISH Non small cell lung cancer Small cell lung cancer Non small cell lung cancer Lung cancer • Symptoms: Persistent cough, coughing up blood, breathlessness, weight loss • GP Specialist Tests: X-ray, scans, biopsy, testing for gene mutations • NSCLC treatments: Surgery (main treatment if the cancer is small and has not spread), chemotherapy, radiotherapy, targeted drugs https://www.cancerresearchuk.org/about-cancer/lung-cancer/treatment/non-small-cell-lung-cancer https://www.nice.org.uk/guidance/dg9/chapter/3-clinical-need-and-practice https://www.nhs.uk/conditions/lung-cancer/treatment/ Non small cell lung cancer (NSCLC) adenocarcinoma: Positive test for epidermal growth factor receptor tyrosine kinase (EGFR-TK) mutation • Treatment with EGFR-TK inhibitor Positive test for anaplastic lymphoma kinase (ALK) fusion genes • Treatment with ALK inhibitor NHS molecular diagnosis of lung cancer type Epidermal growth factor receptor tyrosine kinase (EGFR-TK) mutation testing • The test detects who might benefit from treatment with EGFR–TK inhibitors (anticancer drugs that target specific tumour cells in patients with mutated forms of the EGFR–TK gene) rather than chemotherapy • DNA sequencing technique is used along with more sensitive probe based assay for small amounts of DNA https://meetinglibrary.asco.org/record/89180/edbook#bibr20-EdBookAM201434e353 https://www.nice.org.uk/guidance/dg9/chapter/4-The-diagnostic-tests Normal (unmutated) epidermal growth factor receptor tyrosine kinase (EGFR-TK) Cell EGFR-TKs are located in the cell membrane Cell proliferation and survival Cell proliferation and survival Growth factor ligand Epidermal growth factor receptor tyrosine kinase activity Tyrosine kinases transfer P from ATP onto other proteins to activate them Tyr Tyr Tyr Tyr Tyr Tyr P P P P P P https://meetinglibrary.asco.org/record/89180/edbook#bibr20-EdBookAM201434e353 Epidermal growth factor receptor tyrosine kinase mutants Cell proliferation and survival No ligand binding Cell proliferation and survival Mutant EGFR-TKs are overexpressed (expressed in larger numbers than normal). Mutants are not downregulated by endocytosis https://meetinglibrary.asco.org/record/89180/edbook#bibr20-EdBookAM201434e353 Mutant EGFR-TKs are constitutively active (do not require ligand binding for activation) EGFR-TKIs are small molecules that can diffuse through membranes Cell proliferation and survival EGFR-TKIs compete reversibly with ATP for the ATP binding site Epidermal growth factor receptor tyrosine kinase inhibitors (EGFR-TKIs) Epidermal growth factor receptor tyrosine kinase (EGFR-TK) mutations Mutation hotspot: In NSCLC EGFR-TK mutations are clustered in the kinase domain. At the start of treatment, most patients do not have mutations resistant to EGFR-TKIs https://meetinglibrary.asco.org/record/89180/edbook#bibr20-EdBookAM201434e353 Drug resistance – a huge problem for patients taking EGFR-TK and ALK inhibitors https://www.the-scientist.com/features/how-cancers-evolve-drug-resistance-31742 © NIRJA DESAI Acquired resistance to targeted drug therapy Epidermal growth factor receptor tyrosine kinase (EGFR-TK) drug resistance Acquired resistance is the main limitation of long term use of EGFR-TKIs: 50% of patients develop second site mutations, usually T790M https://meetinglibrary.asco.org/record/89180/edbook#bibr20-EdBookAM201434e353 New EGFR-TKI • Osimertinib • Developed to target T790M mutant EGFR-TKs https://www.videotranslation.net/staying-ahead-of-competition-in-the-market/ Lung cancer https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4367711/ Histology Histology Sequencing FISH Non small cell lung cancer Small cell lung cancer Non small cell lung cancer ALK (anaplastic lymphoma kinase) • ALK was first identified in lymphoma • Tyrosine kinase • Forms fusion protein with EML4 • EML4 and ALK biology is poorly understood • ALK endogenous ligand not yet identified • Despite the unknowns, EML4-ALK fusion protein is successfully inhibited by anticancer drugs https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4761370/ EML4-ALK fusion https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4561238/ https://sangakukan.jp/journal/journal_contents/2013/01/articles/1301-02-1/images/1301-02-1_fig_3.png Inversion produces EML4-ALK fusion gene EML4-ALK fusion protein Echinoderm microtubuleassociated protein-like 4 Anaplastic lymphoma kinase EML4-ALK fusion mutation testing https://issuu.com/iaslc/docs/alk-ros1_atlas_low-res Immunohistochemistry Fluorescence in situ hybridisation (FISH) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3432214/figure/Fig2/ a) EML4-ALK negative: red and green probes are close together (no inversion) FISH results from 3 patients b) and c) EML4-ALK positive: red and green probes are ‘broken apart’ (inversion has produced fusion protein) EML4-ALK is constitutively active (does not require ligand binding for activation) EML4-ALK tyrosine kinase activates proliferation and survival pathways by phosphorylation Tyr Tyr Tyr Tyr P P P P EML4-ALK fusion protein is constitutively active https://www.ncbi.nlm.nih.gov/pubmed/22010214 EML4-ALK inhibition Drug competitively binds the kinase domain ATP pocket to prevent ALK autophosphorylation https://www.ncbi.nlm.nih.gov/pubmed/22010214 Mutation, most commonly L1196M, confers resistance to crizotinib. Thought to be via steric hinderance EML4-ALK drug resistance https://www.ncbi.nlm.nih.gov/pubmed/22010214 Next generation ALK inhibitors • Ceritinib • Alectinib • Prevent ALK phosphorylation • Effective against L1196M https://www.videotranslation.net/staying-ahead-of-competition-in-the-market/ Future of lung cancer treatment • Lung cancer is currently still an area of serious unmet clinical need • 1 in 3 people live for more than a year after diagnosis • 5% of patients survive for 10 years or more • Hope lies with new technologies: more tailored diagnoses and personalised treatments and care http://www.personalisedmedicineappg.org/about https://www.england.nhs.uk/wp-content/uploads/2016/09/improving-outcomes-personalised-medicine.pdf The future of personalised medicine NHS England This leaflet was made in 2016 https://www.youtube.com/watch? v=mecZNDgXtzM Population genetics The genetic composition (gene pool) of populations Natural selection is an important mechanism of evolution. But is it the only mechanism? Nope! In fact, sometimes evolution just happens by chance. In population genetics, evolution is defined as a change in the frequency of alleles (versions of a gene) in a population over time. So, evolution is any shift in allele frequencies in a population over generations – whether that shift is due to natural selection or some other evolutionary mechanism, and whether that shift makes the population better-suited for its environment or not. In this article, we’ll examine genetic drift, an evolutionary mechanism that produces random (rather than selection-driven) changes in allele frequencies in a population over time. What is genetic drift? Genetic drift is change in allele frequencies in a population from generation to generation that occurs due to chance events. To be more exact, genetic drift is change due to “sampling error” in selecting the alleles for the next generation from the gene pool of the current generation. Although genetic drift happens in populations of all sizes, its effects tend to be stronger in small populations. Let’s make the idea of drift more concrete by looking at an example. As shown in the diagram below, we have a very small rabbit population that’s made up of 50 5050 – 50 5050 (or else you might suspect you have a doctored coin)! Allele benefit or harm doesn’t matter Genetic drift, unlike natural selection, does not take into account an allele’s benefit (or harm) to the individual that carries it. That is, a beneficial allele may be lost, or a slightly harmful allele may become fixed, purely by chance. A beneficial or harmful allele would be subject to selection as well as drift, but strong drift (for example, in a very small population) might still cause fixation of a harmful allele or loss of a beneficial one. [How is genetic drift different from natural selection?] The bottleneck effect The bottleneck effect is an extreme example of genetic drift that happens when the size of a population is severely reduced. Events like natural disasters (earthquakes, floods, fires) can decimate a population, killing most individuals and leaving behind a small, random assortment of survivors. The allele frequencies in this group may be very different from those of the population prior to the event, and some alleles may be missing entirely. The smaller population will also be more susceptible to the effects of genetic drift for generations (until its numbers return to normal), potentially causing even more alleles to be lost. How can a bottleneck event reduce genetic diversity? Imagine a bottle filled with marbles, where the marbles represent the individuals in a population. If a bottleneck event occurs, a small, random assortment of individuals survive the event and pass through the bottleneck (and into the cup), while the vast majority of the population is killed off (remains in the bottle). The genetic composition of the random survivors is now the genetic composition of the entire population. The founder effect is another extreme example of drift, one that occurs when a small group of individuals breaks off from a larger population to establish a colony. The new colony is isolated from the original population, and the founding individuals may not represent the full genetic diversity of the original population. That is, alleles in the founding population may be present at different frequencies than in the original population, and some alleles may be missing altogether. The founder effect is similar in concept to the bottleneck effect, but it occurs via a different mechanism (colonization rather than catastrophe). Unlike natural selection, genetic drift does not depend on an allele’s beneficial or harmful effects. Instead, drift changes allele frequencies purely by chance, as random subsets of individuals (and the gametes of those individuals) are sampled to produce the next generation. Every population experiences genetic drift, but small populations feel its effects more strongly. Genetic drift does not take into account an allele’s adaptive value to a population, and it may result in loss of a beneficial allele or fixation (rise to 100 % 100%100, percent frequency) of a harmful allele in a population. The founder effect and the bottleneck effect are cases in which a small population is formed from a larger population. These “sampled” populations often do not represent the genetic diversity of the original population, and their small size means they may experience strong drift for generations. Definitions • Alleles are different forms of a gene • Humans inherit one allele from each parent • Possible genotypes for that locus are: – Homozygous (AA or aa) – Heterozygous (Aa) • Genotype shown is Aa A a Homologous pair of chromosomes Locus (position of gene on the chromosome) Punnett squares By Source (WP:NFCC#4), Fair use, https://en.wikipedia.org/w/index.php?curid=53511831 Reginald Punnett 1875-1967 Both parents heterozygous (Aa) A A a a AA Aa Aa aa P a r e n t 2 Parent 1 Probability • Probability is a measure of how likely it is that something will happen • Probability is always between 0 and 1 Impossible for it to happen Certain it will happen 0 1 https://pixabay.com/en/pigs-fly-funny-hog-piggy-wings-1520968/ https://pixabay.com/en/piglet-young-animals-pig-small-2782611/ Chance that any pig can fly Chance that any pig is an animal Probability • You toss two coins at the same time • The probability of getting all heads ½ x ½ = ¼ or 0.5×0.5=0.25 http://markread.info/2013/11/cutting-edge/ https://www.mathsisfun.com/data/probability-events-independent.html • You toss a fair coin • The probability of getting a head is 50% or ½ or 0.5 • The probability of getting a head or a tail is 100% or 1 • You toss three coins at the same time (or the same coin three times) The idea that landing heads the on the first throw will make tails more likely on the second is known as gamblers fallacy and is false • Hardy-Weinberg equilibrium (also called principle, model, theorem, law) • Hardy-Weinberg equation used to calculate the frequency of genotypes in a population • Population change is measured by changes in genotype frequency • Traditional method of calculating frequency of disease alleles in a population Hardy-Weinberg Genotype frequency • In a live Lego population 40/200 people have white legs phenotype • The Lego alleles for leg colour are: – Dominant allele R (red legs) – Recessive allele r (white legs) • All possible genotypes (allele combinations) in the population: RR, Rr, rR, rr • Genotype for white legs is rr • We can deduce that the frequency of rr genotype is 40/200 = 0.2 • We cannot deduce the frequency of RR and Rr genotypes from the phenotype • We need Hardy-Weinberg for this! Red leg phenotype could result from RR or Rr genotype White leg phenotype only results from rr genotype Hardy-Weinberg equilibrium The frequency of alleles in a population remain unchanged (generation after generation after generation) provided certain conditions are met: • Random mating (certain traits are not chosen) • Large population • No immigration or emigration (no one arrives or leaves the population) • No mutation • No natural selection (all genotypes are equally viable and fertile) • No overlapping generations Hardy-Weinberg equilibrium • Real populations do not remain constant in this way, so why is Hardy-Weinberg equilibrium useful? • We can measure genotype changes in a real population by calculating their deviation from a theoretical unchanging population Hardy-Weinberg equation p 2 + 2pq + q2 = 1 Allele frequency: p + q = 1 • Frequency of the dominant allele in a population: p • Frequency of the recessive allele in a population : q • Everyone in the population must have alleles p or q • Sum of all possible outcomes must =1 (100%) • Therefore allele frequency: p + q = 1 Dominant allele Recessive allele p q • Everyone in the population must have alleles p or q • All possible genotypes (allele combinations) in the population are pp, pq, qp, qq • Frequency of allele 1: p + q = 1 • Frequency of allele 2: p + q = 1 • Genotype frequency: (p + q)(p + q) = 12 Genotype frequency: p2 + 2pq + q2 = 1 Genotype = two alleles Dominant allele Recessive allele p q (p + q)(p + q) = 1 pp + pq + qp + qq = 1 p 2 + 2pq + q2 = 1 Using the Hardy-Weinberg equation p 2 + 2pq + q2 = 1 Frequency of homozygous dominant genotype Frequency of homozygous recessive genotype Frequency of heterozygous genotype Alleles: pp + pq + qp + qq = 1 Using the Hardy-Weinberg equation calculate the frequencies of all leg colour alleles and genotypes in the live Lego population Representative 10% of live Lego population Lego population allele frequencies • 40/200 people have white legs phenotype (rr genotype) • rr genotype frequency: q2 q 2 = 40/200 = 0.2 q = = 0.45 r = 0.45 • Allele frequency: p + q = 1 p = 1 – 0.45 = 0.55 R = 0.55 Dominant allele Recessive allele p R (red legs) q r (white legs) Useful information • rr genotype frequency (homozygous recessive) = q2 = 0.2 • RR genotype frequency (homozygous dominant) = p2 = (0.55)2 = 0.3 • Rr genotype frequency (heterozygous) = 2pq = 2 x 0.55 x 0.45 = 0.5 Lego population genotype frequencies Dominant allele Recessive allele p R (red legs) q r (white legs) Useful information Lego population data Allele frequency p (R) q (r) 0.45 0.55 Genotype frequency 0.3 0.2 0.5 q 2 (rr) p 2 (RR) pq (Rr) Dominant allele Recessive allele p R (red legs) q r (white legs) Useful information Data on leg colour can be recalculated over time to track changes in the population Influences on populations in real life • Mutation • Natural selection • Migration • Non random mating • Genetic drift oFounder effect oBottleneck effect Mutation • Change in DNA sequence • Source of new alleles (genetic diversity) in the gene pool of a population • Not all mutations are passed on to the next generation: they must be in germ line cells to be passed on Natural selection By The National Heart, Lung, and Blood Institute (NHLBI) – http://www.nhlbi.nih.gov/health/health-topics/topics/sca/, Public Domain, https://commons.wikimedia.org/w/index.php?curid=19198765 • Organisms better adapted to their environment survive and produce more offspring – Charles Darwin • Sickle cell disease homozygotes produce sickle cell haemoglobin resulting in anaemia and pain • Normal homozygotes produce no sickle cell haemoglobin • Heterozygotes produce both sickle cell haemoglobin and normal haemoglobin https://en.wikipedia.org/wiki/Tay %E2%80%93Sachs_disease#/media/ File:Autorecessive.svg • The malaria parasite flourishes less well in the blood when sickle cells are present • This confers malarial resistance to heterozygotes • Before malaria treatment, heterozygotes were more likely to survive and produce offspring • This survival advantage has kept the sickle cell allele in the population leading to high incidence of sickle cell disease Migration (gene flow) • Movement from one population to another • Can change allele frequencies in populations • Creates diversity By Jessica Krueger – Own work, CC BY-SA 3.0, https://commons.wikimedia.org/w/index.php?curid=19542551 HH genotype hh genotype Heterozygous Hh genotype due to migration Non random mating • The probability that two individuals in a population will mate is not the same for all possible pairs • Assortative mating: Individuals mate with others who are phenotypically similar (look like them) • Inbreeding: Mating between related individuals Genetic Drift • Change in allele frequency in a population over time • Random changes in the population that may or may not be beneficial • Occurs in populations of all sizes but effect is more prevalent in smaller populations • A harmful allele could potentially reach 100% frequency (fixation) or a beneficial allele could be lost from the population • Bottlenecking and the founder effect increase the influence genetic drift has on allele frequency in a population Founder effect By Founder_effect.png: User:Qz10derivative work: Zerodamage – This file was derived from Founder effect.png:, Public Domain, https://commons.wikimedia.org/w/index.php?curid=20570109 Large original population Smaller groups start new smaller colonies The new population may genetically represent the original population The new population may lose the diversity of the original population • A new isolated group may not represent the diversity of the original population • For example: If the founder(s) carry a disease allele, an unusually high instance of genetic disease may result in the new population • In the Ashkenazi Jewish population: Higher instance of TaySachs disease (TSD). Carrier incidence is 1:30 • 1:4000 births versus 1:320 000 in wider population • Devastating disorder. Most patients die by the age of 4 years Founder effect http://slideplayer.com/slide/4583415/ By Jonathan Trobe, M.D. – http://www.kellogg.umich.edu/theeyeshaveit/congenital/tay-sachs.html, CC BY 3.0, https://commons.wikimedia.org/w/index.php?curid=16368165 https://en.wikipedia.org/wiki/Tay%E2%80%93Sachs_disease#/media/File:Autorecessive.svg Bottlenecking • Significant portion of population wiped out by random environmental event • Reduction in population size: new population may not genetically represent the original • For true bottleneck the chance of survival for individuals must be the same (survival does not depend on individual genetic traits) • Survivor genotypes will be passed to offspring • Population allele frequencies change https://futureoftheocean.wordpress.com/tag/genetic-bottleneck/ Environmental Event Bottlenecking Random environmental Event, wipes out significant portion of population Surviving individuals did so purely by chance The surviving members alleles are now overrepresented in the new population From the Amoeba Sisters YouTube: 5 minute video on genetic drift (highly recommended) https://www.youtube.com/watch?v=W0TM4LQmoZY Original population genotypes: BB, Bb, bb New population genotypes: Bb, bb Breast cancer Breast cancer is the most common cancer in women. Prostate cancer is the most common in men. (UK new diagnoses in 2015.) Breast cancer • In the UK, 1 in 8 women is likely to develop breast cancer at some time in their life • Most cases are sporadic (caused by genetic mutations that are not inherited) Hereditary breast cancer 5-10% of breast cancers are hereditary Characteristics: • Clusters in families ‒ Families with both breast and ovarian cancer ‒ Families with male breast cancer ‒ Lower age of onset ‒ Bilateral cancer Mutation of BRCA1 and BRCA2 genes • The most common known cause of hereditary breast cancer is mutation of BRCA1 or BRCA2 • These two genes account for approximately 20% of familial breast cancers. Research to identify new genes that also contribute to a high risk of breast cancer is ongoing. Facts and figures • BRCA1 gene • 17q21.31 • 24 exons • 100kb genomic DNA • 100s mutations identified • BRCA1– tumour suppressor gene • DNA repair • BRCA2 – gene • 13q13.1 • 28 exons • 70kb genomic • BRCA2 – tumour suppressor gene • DNA repair BRCA1 and BRCA2 facts and figures https://www.youtube.com/watch?v=-GwdZIqJf8g BRCA1 and BRCA2 mutation increase the risk of developing certain types of cancer Ovarian cancer Early age onset breast cancer Second primary breast cancer Prostate cancer Male breast cancer BRCA1/2 inheritance is autosomal dominant Autoso mes Gene can be inherited from either parent 50% chance of inheriting the gene if a patent is positive One mutated allele (copy of the gene) confers increased risk https://en.wikipedia.org/wiki/ Tumour suppressor genes Single mutation inactivates gene on one allele Second mutation inactivates gene on second allele Enough tumour suppressor protein is produced• Tumour suppressor gene mutations are deactivating mutations called ‘loss of function’ (e.g. the mutation stops the encoded protein being produced) • Tumour suppressor gene mutations are recessive: mutation of both copies is needed to prevent production of the tumour suppressor protein Figure 23-24 Albt• BRCA1/2 inheritance is dominant because one mutated allele (copy of the gene) confers increased risk • Loss of tumour suppressor protein is recessive because both genes must be mutated to prevent production of the tumour suppressor protein Tumour suppressor genes Tumour suppressor gene + function of both alleles lost = protein that supresses proliferation is not produced Tumour suppressor gene inactivation is analogous to having no brakes (unable to stop cell division) BRCA1 and BRCA2: Genetic predisposition to cancer • Breast cancer is more common in women than in men, but the mutated gene can be inherited from the mother or father • One copy of the altered gene increases the chance of developing cancer • People inherit an increased likelihood of developing cancer • Not everyone who inherits the mutation of BRCA1 or BRCA2 will ultimately develop cancer Knudson’s two-hit hypothesis Cancer BRCA1 and BRCA2 and cancer risk https://www.nytimes.com/2 013/05/14/opinion/my-medi cal-choice.html Royal Marsden NHS Foundation Trust 2014 Average cancer risk with BRCA1 or BRCA2 mutation compared to no BRCA mutation Ashkenazi Jewish population Ashkenazi Jewish population • Study of specific mutations in Ashkenazi Jews • Combined prevalence of BRCA1/2 mutation is 2.6% as opposed to 0.2% in the general USA population • Three founder mutations (due to common ancestral origins and endogamy) have been identified at a higher frequency than the other BRCA1 or BRCA2 gene mutations • BRCA1: 187delAG • BRCA1: 5385insC • BRCA2: 6174delT • About 78 to 96% of Ashkenazi Jews with BRCA1/2 mutations carry one of the founder mutations • Founder mutations provide a highly efficient means of determining carrier status (geneticists know which mutationstolookfor) Case study: the Wilson family • Wendy Wilson saw a television program about familial breast cancer • Became concerned about her own family • Her mother had breast cancer and died aged 42 • 3 other relatives had breast cancer including her aunt (aged 40) and cousin (age 36) and a male second cousin • Wendy was referred by her GP for genetic testing Breast cancer gene carried but disease not developed Not related as all breast cancer is on Wendy’s mother’s side of the family The Wilson pedigree The Wilson pedigree Mutation testing • Tumour tissue from Wanda (Wendy’s mother) was obtained from pathology lab archive and DNA extracted • Deletion in exon 18 of BRCA2 was found. This caused a frameshift creating a stop codon • To confirm this was the ‘first hit’ mutation Wanda’s sister (Wendy’s aunt) was contacted for a blood sample. She also carried this mutation • Family mutation was identified • Other family member blood samples were tested • Veronica and William carried the mutation but Wendy did not Mutation testing Genetic counselling for female with no BRCA2 mutation: Wendy • Important for her to realise that she could still develop sporadic forms of breast cancer • She should still attend the standard mammogram screening program • Risk is strongly influenced by lifestyle – reduce risk by 40% by: • Maintaining a healthy weight • Physical exercise • Healthy diet • Not smoking • Reducing alcohol consumption Genetic counselling for BRCA2 mutation carrier (female): Veronica • Carried mutation so at high risk of developing breast cancer • Increased risk of ovarian cancer • Options • Do nothing • Lifestyle changes • Enhanced surveillance program – annual mammography • Tamoxifen – may reduce risk • Prophylactic mastectomy (breast removal) • Prophylactic salpingectomy (removal of ovaries and fallopian tubes) Genetic counselling for BRCA2 mutation carrier (male): William • Breast cancer is very rare in males so although he is a carrier his absolute risk is low • Increased risk of prostate cancer – attend regular screening • His daughters would need counselling (plus testing if they choose) as they are at substantial risk of breast cancer • If they inherit the gene his sons are at increased risk of prostate cancer and risk passing the mutation onto their children What is the human genome? The complete set of human genes plus all the non-coding DNA nucle us Courtesy: National Human Genome Research Institute Mitochondrial DNA in circular molecules ~16 thousand base pairs (sequenced 1981)https://commons.wikimedia.org/w/index.php? curid=53240683 Nuclear DNA in chromosomes ~3 billion base pairs Composition of the human genome Human genome is 1-2% protein coding genes https://upload.wikimedia.org/wikipedia/commons/a/ad/ Components_of_the_human_genome.png NIH says 1% What is the Human Genome Project? • Project to sequence the whole human genome 1990-2000 • Goals of the project (ongoing) • Obtain the sequence of all nucleotides (ATGC) that make up human DNA • Identify all genes in human DNA • Store all the data on databases and create tools to analyse the information • Address ethical, legal and social issues arising from the project International collaborative research program • Conducted by thousands of scientists from 6 countries • Landmark in international cooperation in biological science. • Original paper: “Initial sequencing and analysis of the human genome” of ~2900 authors – currently the most co-authored paper in biological sciences https://www.yourgenome.org/stories/who-was-involved-in-the-human -genome-project Team from The Sanger Centre, Cambridge, UK https://www.researchgate.net/publication/311545862_Supplementar y_Information_for_Initial_Sequencing_and_Analysis_of_the_Human_ Genome_Nature_V412_565 A complete list of the authors can be found here: Collaborators 1. Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridgeshire, UK 2. Broad Institute/Whitehead Institute/MIT Center for Genome Research, Cambridge, Massachusetts, USA 3. Washington University School of Medicine Genome Sequencing Center, St. Louis, Missouri, USA 4. Joint Genome Institute, US Department of Energy, Walnut Creek, California, USA 5. Baylor College of Medicine Human Genome Sequencing Center, Department of Molecular and Human Genetics, Houston, Texas, USA 6. RIKEN Genomic Sciences Center, Yokohama-city, Japan 7. Genoscope and CNRS, UMR-8030, Evry Cedex, France 8. Genome Therapeutics Corporation (GTC) Sequencing Center, Genome Therapeutics Corporation, Waltham, Massachusetts, USA 9. Department of Genome Analysis, Institute of Molecular Biotechnology, Jena, Germany 10. Beijing Genomics Institute/Human Genome Center, Institute of Genetics, Chinese Academy of Sciences, Beijing, China 11. Multimegabase Sequencing Center, The Institute for Systems Biology, Seattle, Washington, USA 12. Stanford Genome Technology Center, Stanford, California, USA 13. Stanford Human Genome Center and Department of Genetics, Stanford University School of Medicine, Stanford, California, USA 14. University of Washington Genome Center, Seattle, Washington, USAKEY 15. Department of Molecular Biology, Keio University School of Medicine, Tokyo, Japan 16. University of Texas Southwestern Medical Center at Dallas, Dallas, Texas, USA* 17. University of Oklahoma’s Advanced Center for Genome Technology, Department of Chemistry and Biochemistry, University of Oklahoma, Norman, Oklahoma, USA 18. Max Planck Institute for Molecular Genetics, Berlin, Germany 19. Cold Spring Harbor Laboratory, Lita Annenberg Hazen Genome Center, Cold Spring Harbor, New York, USA 20GesellschaftfürBiotechnologischeForschungmbH(GBF)https://en.wikipedia.org/wiki/M ain_Page https://www.europeancitiesma rketing.com https://www.yourgenome.org/stories/who-was-involved-in-the-hu man-genome-project Funding and costs • The vast majority of the project was paid for by US Taxpayers from the Department of Energy and US National Institutes of Health budgets • Contributions were made by the UK from the Medical Research Council and the Wellcome Trust • Final cost $2.7 billion https://pixabay.com/en/dna-string-biology-3d-1811955/ Human Genome Project sequencing Human Genome Project sequencing • The haploid genome was sequenced https://science.howstuffworks.com/life/cellularmicroscopic/cell6.htm • Bases are paired so only one DNA strand needed to be sequenced https://commons.wikimedia.org/wiki/ File:Haploid,_diploid_,triploid_and_tetraploid.svg Genetic analysis in the early 2000s http://cgil.uoguelph.ca/QTL/ABI377.htm http://cgil.uoguelph.ca/QTL/ABI377.htm https://users.ugent.be/~avierstr/principles/seq.html International Human Genome Sequencing Consortium: sequencing technique 2001 Nature Publishing Group, International Human Genome Sequencing Consortium, Initial sequencing and analysisofthehumangenomeNature409860–921 Genomic DNA Many men and women donated blood for the HGP DNA extracted from white blood cells It is not known which DNA sample(s) were used for sequencing Genomic DNA Organised mapped large fragments (clone contigs) By sequencing out of the known BAC sequence the ends of the genomic DNA can be sequenced The large fragments can be matched end to end in order Where can the DNA sequence be found? http://www.sanger.ac.uk/resources/downloads/ human/ Whole genome sequencing https://www.genome.gov/images/illustrations/sequencHuman Genome Project reference sequence Compare person’s generated sequence to reference sequence to identify differences “$1000 Genome” Grants • “$1000 Genome” Grants issued by the National Human Genome Research Institute since 2004 have kept up the momentum of genomic research • $230 million dollars awarded to 97 groups of academic and industrial scientists • This has helped start a number of genomics companies and develop new sequencing methods https://www.nature.com/news/technology-the-1-00 0-genome-1.14901 • Current costs are estimated around $1000-$2000 • Companies have reported to have been able to sequence a human genome for $1000 or less • May not include operational and labour costs • May not represent costs to the customer Cost per genome https://www.genome.gov/sequencingcosts/ https://www.genome.gov/27565109/the-cost-of-sequencing -a-human-genome/ Ethical, Legal and Social Implications (ELSI) of the Human Genome Project ELSI • Set up 1990 • Allocated 3-5% of the Human Genome Project budget Aims: • Privacy and fair use of genetic information • Informed consent • Medical use of new genetic technologies (Clinical Integration) • Education https://www.genome.gov/pages/research/der/elsi/ erpegreportpdfhttps://www.genome.gov/10001618/the-elsi-research-program/ ELSI Mission statement: “To identify, analyze, and address the ethical, legal and social implications of the Human Genome Project (HGP) at the same time that the basic scientific issues are being studied” Bermuda principles 1996 • 1996 meeting of leaders of The Human Genome Project • Agreement that all sequences will made freely available in the public domain within 24 hours • To maximise benefits to society • Reshaped practices in the whole field • Standard practice in research is for small independent groups to publish data https://unlockinglifescode.org/timeline?ti Privacy and fair use of genetic information • Public policies created to protect genetic privacy and prevent discrimination (informed by ELSI research) • Reduce likelihood of genetic discrimination (insurers and employers) • Reduce misuse/misinterpretation of genetic information https://www.genome.gov/pages/research/der/elsi /tdfhttp://www.genewatch.org/sub-396521 Informed consent • Ensure everyone participating in research is properly informed (participants must know in advance what will happen to their samples and who will find out information about them) • Research must be designed, conducted and reported in an ethically sound manner http://www.genewatch.org/sub-396522 https://www.genome.gov/pages/research/der/elsi/er Medical use of new genetic technologies (Clinical Integration) • Research plus healthcare • Ensure new technologies developed as a result of the Human Genome Project are safe, fair and effective for patients • Safe, timely, effective, efficient, equitable, and patient-focused http://chn4kids.org/category/clinical-integration/ https://www.genome.gov/pages/research/der/elsi/erphttps://www.genome.gov/10001727/erpeg-final-repor Education • ELSI hope to educate as many people as possible of all ages including professionals, health workers and members of the public • Make people aware of the Human Genome Project and future research (clinicians and scientists want people to understand and participate in research) • Developed online educational resources https://www.genome.gov/25019879/onlin e-education-kit-understanding-the-humangenome-project/ https://www.genome.gov/pages/research/der/elsi/ erpegreport.pdf Basic understanding of the Human Genome Project • Short educational videos for better understanding : https://www.youtube.com/playlist?list=PLF0701633C 91835BF https://www.genome.gov/human-genome-project/Co mpletion-FAQ 100 000 Genomes Project • Funded by UK Department of Health • Run by Genomics England • Aims: 1. Set up the first NHS genomic medicine service 2. Ensure ethical transparent consent of patients 3. Gain scientific and medical knowledge 4. Encourage a UK genomics industry • 50 000 cancer genomes (patients) • 50 000 rare disease genomes (patients plus relatives) • Rare disease affect 3 million people in UK (there are 5000-8000 rare diseases) • Hope to find diagnosis and treatment 100 000 Genomes Project DNA DNA Patient’s normal cells Patient’s cancer cells Compare sequences to find cancer mutation https://commons.wikimedia.org/wiki/ 100 000 Genomes Project: 50 000 cancer genomes https://www.genomicsengland.co.uk/the-100000-genomes-project/underst anding-genomics/8335-2/ PALB2 mutation • 60% chance of developing cancer • 50:50 chance they will pass the mutation to children •4thsistercarriesmutation4 sisters, 3 diagnosed with breast cancer, no BRCA mutation https://www.youtube.com/watch?v=BMw0nfIDixM 100 000 Genomes Project: 50 000 rare disease genomes Leopard syndrome (Noonan’s Syndrome) If testing had been available the family would have been prepared for the treatments and surgeries needed Since testing they have had support from other families and know more about what the future holds 100 000 Genomes project: 50 000 rare disease genomes https://www.youtube.com/watch?v=hxou7ayQSZQ • Epilepsy and mobility problems • Without genetic analysis there is a journey of trial and error to find a treatment that works best • Genome sequencing showed: • Glut1 mutation • Not found in either parent Knowledge disorder is not inherited if family have another child Specific treatment Panel of clinicians and scientists discuss direct to consumer tests Listen to a recording of the discussion or read the article Self study is needed for first class marks Direct to consumer genetic testing https://www.bmj.com/content/367/bmj.l5688.abstract